Mutagenetix > Incidental Mutation

Incidental Mutation 'R1989:Sall2'

223089

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

040001-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1989 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 52314439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 431 (P431L)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: P433L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: P433L

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: P431L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	A	6: 146,952,896	D216V	possibly damaging	Het
Acaca	T	C	11: 84,262,529	M921T	probably damaging	Het
Actn2	A	T	13: 12,340,395	W36R	probably benign	Het
Adcy9	A	T	16: 4,298,727	V643D	probably damaging	Het
Agbl4	A	T	4: 111,566,682	T302S	possibly damaging	Het
Akap13	A	G	7: 75,704,516	N1795S	probably benign	Het
Ang	T	A	14: 51,101,551	C50S	probably damaging	Het
Anxa13	T	A	15: 58,341,948		noncoding transcript	Het
Asxl3	T	C	18: 22,452,363	V115A	probably damaging	Het
B4galt5	A	T	2: 167,305,003	W304R	probably damaging	Het
Bptf	T	C	11: 107,074,826	K1118E	probably damaging	Het
Cacna1b	T	C	2: 24,721,374	Y335C	probably damaging	Het
Catsperb	A	T	12: 101,602,711	I881F	probably damaging	Het
Chrm5	A	G	2: 112,480,252	V173A	probably damaging	Het
Cyfip2	A	T	11: 46,253,998	Y676*	probably null	Het
Cyp2f2	A	G	7: 27,129,203	D90G	probably damaging	Het
Cyr61	A	T	3: 145,647,743	Y355N	probably benign	Het
Dnah5	T	C	15: 28,343,591	I2379T	probably damaging	Het
E2f8	T	C	7: 48,873,280	E349G	probably benign	Het
Ebf1	T	C	11: 44,621,966	M134T	probably damaging	Het
Fn1	T	C	1: 71,651,625	H59R	probably damaging	Het
Focad	T	C	4: 88,232,784		probably null	Het
Gabra1	A	T	11: 42,155,015	D89E	probably damaging	Het
Hip1r	G	T	5: 123,989,698	V90F	probably damaging	Het
Ifi213	C	A	1: 173,568,808		probably null	Het
Kcnj9	A	G	1: 172,326,149	I136T	probably benign	Het
Kmt2c	A	G	5: 25,498,544	S3P	possibly damaging	Het
Lrrc4b	GAGAAG	GAG	7: 44,462,230		probably benign	Het
Lrrk1	G	A	7: 66,281,684	S43L	probably damaging	Het
Macf1	A	G	4: 123,497,726		probably null	Het
Mad1l1	A	G	5: 140,303,670	S167P	probably benign	Het
Maml3	G	T	3: 51,697,758	A64D	probably damaging	Het
Mgat4c	T	C	10: 102,378,159	M1T	probably null	Het
Mkrn2os	G	T	6: 115,589,350	T88K	probably damaging	Het
Mob3c	T	C	4: 115,831,557	Y96H	probably damaging	Het
Mpo	T	A	11: 87,803,472	I96N	probably damaging	Het
Mup17	T	A	4: 61,593,623	Y138F	probably benign	Het
Myh8	A	G	11: 67,292,724	I754V	probably benign	Het
Naa30	T	A	14: 49,178,140	L289*	probably null	Het
Nap1l4	A	C	7: 143,527,184	F292V	probably damaging	Het
Nek5	T	A	8: 22,111,169	N129Y	probably damaging	Het
Nlrp9a	A	G	7: 26,573,913	E880G	probably benign	Het
Nsun6	G	T	2: 15,038,184	N155K	probably benign	Het
Olfr1189	T	A	2: 88,592,599	I265K	probably damaging	Het
Olfr1318	T	A	2: 112,156,377	I142N	probably benign	Het
Olfr170	A	T	16: 19,606,657	Y4N	probably benign	Het
Olfr467	A	T	7: 107,814,700	I39L	probably benign	Het
Olfr600	T	A	7: 103,346,109	Y273F	possibly damaging	Het
Olfr622	A	T	7: 103,639,495	I215K	probably damaging	Het
Olfr930	T	C	9: 38,930,875	S235P	possibly damaging	Het
Palm3	G	A	8: 84,030,022	S721N	possibly damaging	Het
Ppp2r5d	C	T	17: 46,684,099	V559M	probably benign	Het
Ptgfr	A	T	3: 151,835,339	Y177*	probably null	Het
Rnase10	A	T	14: 51,009,638	I121L	probably benign	Het
Sbf2	A	G	7: 110,348,923	V1194A	possibly damaging	Het
Scimp	T	C	11: 70,791,576	K105E	possibly damaging	Het
Scrt2	A	T	2: 152,082,087	D13V	probably damaging	Het
Snx19	A	G	9: 30,428,108	S181G	possibly damaging	Het
Spata2	G	A	2: 167,484,314	T195M	possibly damaging	Het
Sptbn4	A	G	7: 27,367,702	V614A	probably damaging	Het
Srpk2	G	A	5: 23,518,423	A565V	probably damaging	Het
Stard9	A	G	2: 120,701,406	I2715V	probably benign	Het
Sval1	A	G	6: 41,955,491	T92A	possibly damaging	Het
Synrg	T	C	11: 84,019,955		probably null	Het
Tlr12	T	C	4: 128,617,069	T463A	probably benign	Het
Tnxb	A	G	17: 34,683,377	H945R	probably benign	Het
Tnxb	A	T	17: 34,693,885	D1791V	probably damaging	Het
Topaz1	C	T	9: 122,750,125	T700I	possibly damaging	Het
Trappc8	A	G	18: 20,845,651	V796A	probably benign	Het
Trpm1	A	T	7: 64,209,032		probably null	Het
Ttll4	G	T	1: 74,685,368	V566L	possibly damaging	Het
Ttn	T	A	2: 76,750,941	N23203Y	probably damaging	Het
Ttn	A	T	2: 76,770,787	Y18781N	probably damaging	Het
Tuba3a	T	C	6: 125,281,253	N258S	probably damaging	Het
Upk1b	A	T	16: 38,784,241	W141R	possibly damaging	Het
Vars	T	C	17: 35,011,838	F567L	possibly damaging	Het
Vcpip1	G	C	1: 9,745,563	A865G	probably benign	Het
Vmn2r22	A	T	6: 123,637,541	F363L	probably damaging	Het
Vmn2r66	A	T	7: 85,011,993	F10I	probably benign	Het
Wbp2	C	T	11: 116,080,221		probably null	Het
Yy1	T	C	12: 108,806,608	L270P	probably damaging	Het
Zan	A	T	5: 137,420,006	C2943*	probably null	Het
Zfp51	T	A	17: 21,456,320	Y18N	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TTGTTGAAAGTAGGGAGCCCAG -3'
(R):5'- ACAAATGCCGCTTTTGTGC -3'

Sequencing Primer
(F):5'- CACTGCTGTGCTTGTGCCAG -3'
(R):5'- TTGTGCAAAAGTATTCGGCAGTGAC -3'

Posted On

2014-08-25