Mutagenetix > Incidental Mutations

Incidental Mutation 'R4592:Sall2'

342922

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

041808-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52313803 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 643 (R643L)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: R645L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: R645L

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: R643L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.2114

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	G	11: 97,771,615	S144P	probably damaging	Het
4933430I17Rik	T	A	4: 62,538,927	V161E	possibly damaging	Het
Arhgap40	T	C	2: 158,546,709	V521A	possibly damaging	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
Casp12	T	C	9: 5,352,923		probably benign	Het
Ccdc189	C	T	7: 127,585,491	R172H	probably benign	Het
Cenpf	G	A	1: 189,679,033	T318M	probably damaging	Het
Clcn2	T	C	16: 20,709,142	K525E	probably damaging	Het
Cntln	A	G	4: 84,971,182	T301A	probably benign	Het
Crat	T	C	2: 30,415,366		probably benign	Het
Cul5	A	G	9: 53,633,727		probably benign	Het
Cxcl14	A	T	13: 56,295,895	I34N	probably damaging	Het
Cyp2b19	A	G	7: 26,771,394	I487V	probably benign	Het
Cyp4a10	T	A	4: 115,529,493	F446I	probably damaging	Het
D430041D05Rik	T	A	2: 104,233,479	M659L	possibly damaging	Het
Dclk3	T	C	9: 111,467,895	F169S	probably damaging	Het
Ddx52	T	C	11: 83,957,480	I532T	probably damaging	Het
Dnm1	T	C	2: 32,336,011	D352G	probably damaging	Het
Eif4g2	T	C	7: 111,078,302	E174G	probably damaging	Het
Enpp6	G	T	8: 47,093,032	V386L	probably damaging	Het
Eps15l1	T	C	8: 72,341,394	D904G	probably damaging	Het
Esrrb	A	G	12: 86,518,830	Y356C	probably damaging	Het
Flt3	A	T	5: 147,354,699	S619T	possibly damaging	Het
Fndc7	A	T	3: 108,858,902	C716S	probably damaging	Het
Gm10125	T	C	18: 5,525,375		noncoding transcript	Het
Gm26996	T	A	6: 130,579,485		noncoding transcript	Het
Grik2	A	T	10: 49,422,615	F50I	possibly damaging	Het
Guf1	T	C	5: 69,566,443	V367A	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ifnar2	T	C	16: 91,391,796	V55A	probably benign	Het
Impg1	T	A	9: 80,440,854	I33F	probably benign	Het
Ltbp4	A	C	7: 27,325,183	V674G	probably damaging	Het
Mroh2b	T	A	15: 4,918,290	L529H	probably damaging	Het
Negr1	T	C	3: 157,208,386		probably benign	Het
Neurog3	A	G	10: 62,133,820	T25A	probably damaging	Het
Olfr1241	T	A	2: 89,482,756	K126N	probably damaging	Het
Olfr1420	T	C	19: 11,896,762	V247A	probably benign	Het
Olfr181	T	C	16: 58,926,092	T160A	probably benign	Het
Olfr555	A	C	7: 102,659,478	Y219S	probably damaging	Het
Pax8	T	A	2: 24,443,189		probably benign	Het
Pcsk6	A	C	7: 65,931,732	I254L	possibly damaging	Het
Pde3a	A	G	6: 141,459,216	K389R	probably benign	Het
Rab3gap1	C	A	1: 127,925,259		probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rptor	A	G	11: 119,798,840	D321G	probably null	Het
Sdccag3	C	A	2: 26,388,897		probably benign	Het
Skp1a	T	C	11: 52,243,619	I59T	possibly damaging	Het
Slc23a3	T	G	1: 75,128,556	N456T	probably damaging	Het
Slc4a7	G	A	14: 14,778,850	G920S	probably damaging	Het
Smarcd3	T	C	5: 24,592,804	I467V	probably benign	Het
Spata31d1c	C	T	13: 65,036,060	A472V	probably damaging	Het
Srsf6	T	C	2: 162,931,723	I18T	probably damaging	Het
Stom	C	T	2: 35,323,746	G80D	probably damaging	Het
Svep1	A	T	4: 58,084,028	Y1915N	possibly damaging	Het
Tmf1	C	T	6: 97,173,400	V449I	probably benign	Het
Triobp	C	T	15: 78,967,095	A483V	probably benign	Het
Vdac1	G	A	11: 52,374,972		probably null	Het
Vmn2r75	T	G	7: 86,166,286	E123D	probably benign	Het
Vmn2r79	T	A	7: 87,004,111	V528D	possibly damaging	Het
Zdbf2	T	G	1: 63,306,591	N1376K	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- ACATGTTGCTGCAGAGTGAC -3'
(R):5'- CCTTATGTGCTAGAACCCTTGGG -3'

Sequencing Primer
(F):5'- CAGAGTGACAGCATTAGTGAACTTC -3'
(R):5'- GCCTTCTGAGACCTCAAAGCTG -3'

Posted On

2015-09-24