Incidental Mutation 'R6456:Sall2'
ID520218
Institutional Source Beutler Lab
Gene Symbol Sall2
Ensembl Gene ENSMUSG00000049532
Gene Namespalt like transcription factor 2
SynonymsMsal-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52311172-52328762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52313593 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 715 (Q715L)
Ref Sequence ENSEMBL: ENSMUSP00000056401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]
Predicted Effect probably damaging
Transcript: ENSMUST00000058326
AA Change: Q715L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: Q715L

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
ZnF_C2H2 372 394 2.57e-3 SMART
ZnF_C2H2 400 422 1.28e-3 SMART
low complexity region 476 501 N/A INTRINSIC
low complexity region 602 627 N/A INTRINSIC
ZnF_C2H2 629 651 1.2e1 SMART
ZnF_C2H2 657 679 1.69e-3 SMART
ZnF_C2H2 689 711 6.88e-4 SMART
low complexity region 719 730 N/A INTRINSIC
low complexity region 747 779 N/A INTRINSIC
low complexity region 799 819 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
ZnF_C2H2 908 930 2.09e-3 SMART
ZnF_C2H2 937 960 1.01e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135523
AA Change: Q713L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Sall2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Sall2 APN 14 52314571 missense probably damaging 1.00
IGL02152:Sall2 APN 14 52315514 missense probably damaging 1.00
IGL02318:Sall2 APN 14 52315565 missense probably damaging 1.00
IGL02933:Sall2 APN 14 52313027 missense probably benign 0.00
IGL03165:Sall2 APN 14 52314168 missense probably damaging 1.00
R1079:Sall2 UTSW 14 52313203 missense probably benign 0.13
R1295:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1674:Sall2 UTSW 14 52313836 missense probably damaging 1.00
R1840:Sall2 UTSW 14 52313725 missense probably damaging 1.00
R1989:Sall2 UTSW 14 52314439 missense probably damaging 1.00
R2339:Sall2 UTSW 14 52313356 missense probably damaging 1.00
R3407:Sall2 UTSW 14 52328104 missense probably benign 0.03
R3870:Sall2 UTSW 14 52313994 missense probably damaging 1.00
R3895:Sall2 UTSW 14 52314047 missense probably damaging 0.99
R4059:Sall2 UTSW 14 52314571 missense probably damaging 1.00
R4272:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4273:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4275:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4289:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4503:Sall2 UTSW 14 52313459 missense probably benign
R4592:Sall2 UTSW 14 52313803 missense probably damaging 1.00
R4611:Sall2 UTSW 14 52313753 missense probably damaging 1.00
R4615:Sall2 UTSW 14 52312750 missense probably benign 0.20
R4640:Sall2 UTSW 14 52315159 missense probably damaging 0.99
R4693:Sall2 UTSW 14 52314478 missense probably damaging 1.00
R4921:Sall2 UTSW 14 52315393 missense possibly damaging 0.93
R5007:Sall2 UTSW 14 52314493 missense probably damaging 1.00
R5015:Sall2 UTSW 14 52315655 missense possibly damaging 0.92
R5079:Sall2 UTSW 14 52314754 missense probably damaging 1.00
R5419:Sall2 UTSW 14 52313129 missense probably damaging 1.00
R5849:Sall2 UTSW 14 52314247 missense probably benign 0.13
R6229:Sall2 UTSW 14 52313191 missense probably benign
R6397:Sall2 UTSW 14 52315153 missense probably damaging 1.00
R6422:Sall2 UTSW 14 52312724 makesense probably null
R6456:Sall2 UTSW 14 52313594 nonsense probably null
R6786:Sall2 UTSW 14 52314621 missense probably damaging 1.00
R7293:Sall2 UTSW 14 52314411 nonsense probably null
R7496:Sall2 UTSW 14 52315561 missense possibly damaging 0.63
R7792:Sall2 UTSW 14 52316064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCGTACTGATATGGCCTTC -3'
(R):5'- TGTAAAGTGTGTGGCCGAGC -3'

Sequencing Primer
(F):5'- AGGGAATCTTCATCTGTCACG -3'
(R):5'- CTTTCTCCACAAGGGGCAATTTG -3'
Posted On2018-06-06