Mutagenetix > Incidental Mutation

Incidental Mutation 'R6456:Sall2'

520218

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6456 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52313593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 715 (Q715L)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: Q715L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: Q715L

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: Q713L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,685,169	H310L	probably damaging	Het
9930021J03Rik	G	A	19: 29,716,514	P1860S	possibly damaging	Het
Abca13	A	T	11: 9,290,474	H779L	possibly damaging	Het
Abca7	T	C	10: 80,015,150	V2097A	probably null	Het
Adam8	A	G	7: 139,986,788	S524P	possibly damaging	Het
Anapc2	T	C	2: 25,280,195	M575T	probably damaging	Het
Arhgap42	T	A	9: 9,005,822	I736L	probably benign	Het
AU040320	A	G	4: 126,842,491	N789S	probably benign	Het
Bmi1	A	G	2: 18,682,247	Y46C	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cd180	C	T	13: 102,702,836	L76F	probably damaging	Het
Cep135	T	C	5: 76,591,724		probably benign	Het
Col6a5	G	A	9: 105,945,477	T227I	unknown	Het
Cyp4a29	G	T	4: 115,251,184	M368I	probably benign	Het
Ddx28	T	A	8: 106,010,368	I353F	possibly damaging	Het
Ddx58	T	A	4: 40,213,838	N607Y	possibly damaging	Het
Dhx40	G	A	11: 86,784,974	T198M	probably damaging	Het
Fam71f1	A	G	6: 29,334,046	N299S	probably benign	Het
Fat4	G	A	3: 38,983,979	V3927M	possibly damaging	Het
Gm10226	G	T	17: 21,692,025	G56*	probably null	Het
Gm11127	A	T	17: 36,056,610	Y279N	probably damaging	Het
Itsn2	T	G	12: 4,629,923		probably benign	Het
Lrrc8a	A	G	2: 30,255,474	D100G	probably benign	Het
Madd	T	C	2: 91,178,191	H122R	probably benign	Het
Mfsd4b3	C	G	10: 39,947,320	V315L	probably benign	Het
Mki67	C	G	7: 135,699,475	A1277P	possibly damaging	Het
Nlrp9b	T	A	7: 20,048,778	N872K	probably damaging	Het
Npas1	T	C	7: 16,461,926	T274A	probably benign	Het
Nrm	A	T	17: 35,865,400		probably null	Het
Olfr418	A	T	1: 173,270,538	D121V	probably damaging	Het
Pdilt	T	A	7: 119,500,483	L187F	probably damaging	Het
Pkdcc	T	C	17: 83,220,119	I242T	probably damaging	Het
Plch2	C	A	4: 154,993,002	D535Y	probably damaging	Het
Pmpca	T	A	2: 26,395,167	I468N	probably damaging	Het
Prpf4	T	C	4: 62,414,632		probably null	Het
Rcc1	A	G	4: 132,334,116	S361P	probably benign	Het
Rnf213	A	G	11: 119,459,966	I3876V	probably benign	Het
Sin3a	A	G	9: 57,113,701	S1004G	possibly damaging	Het
Sltm	C	T	9: 70,542,987	T23M	probably damaging	Het
Sspo	A	G	6: 48,451,806	E385G	probably benign	Het
Syne3	G	T	12: 104,940,704	R775S	possibly damaging	Het
Szt2	A	T	4: 118,376,697		probably benign	Het
Tlk2	T	C	11: 105,221,273	S151P	probably benign	Het
Trabd2b	C	T	4: 114,586,560	R305C	probably damaging	Het
Ttc21b	T	C	2: 66,188,331	Q1244R	probably damaging	Het
Vmn2r125	A	G	4: 156,351,062	N245S	probably benign	Het
Wdr34	T	C	2: 30,032,767	S323G	probably benign	Het
Wdr64	G	A	1: 175,785,609		probably null	Het
Wdr70	G	A	15: 7,885,637	T550M	possibly damaging	Het
Wdr78	A	C	4: 103,049,549	M689R	probably benign	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- ACCTCGTACTGATATGGCCTTC -3'
(R):5'- TGTAAAGTGTGTGGCCGAGC -3'

Sequencing Primer
(F):5'- AGGGAATCTTCATCTGTCACG -3'
(R):5'- CTTTCTCCACAAGGGGCAATTTG -3'

Posted On

2018-06-06