Mutagenetix > Incidental Mutation

Incidental Mutation 'R9571:Sall2'

722010

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9571 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 52314373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 455 (V455E)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: V455E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: V455E

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: V453E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020A23Rik	A	G	2: 130,405,562	D6G	probably benign	Het
Abl2	T	G	1: 156,641,514	S783A	probably damaging	Het
Adamtsl1	A	T	4: 86,199,306	T169S	probably benign	Het
Adcy9	A	G	16: 4,323,789	V621A	probably benign	Het
Ahnak2	T	C	12: 112,776,076	S521G	possibly damaging	Het
Ap2m1	G	A	16: 20,541,287	G213R	probably damaging	Het
Apol11b	C	T	15: 77,640,571	E5K	possibly damaging	Het
Arl4d	T	C	11: 101,667,206	M186T	possibly damaging	Het
Cep192	A	G	18: 67,819,038	D428G	probably damaging	Het
Ckap5	A	C	2: 91,557,608	D266A	probably damaging	Het
Crls1	A	T	2: 132,849,873	N106I	probably damaging	Het
Csmd3	T	A	15: 48,792,002		probably benign	Het
Csnk1a1	A	G	18: 61,571,898	R161G	possibly damaging	Het
Cyp4f39	T	A	17: 32,483,222	I231N	probably damaging	Het
Ddx31	T	A	2: 28,860,022	V352D	probably damaging	Het
Dna2	A	G	10: 62,964,961	D758G	probably damaging	Het
Gatad2a	C	A	8: 69,917,731	A172S	probably benign	Het
Ghsr	G	T	3: 27,372,515	R240L	probably benign	Het
Gli3	T	A	13: 15,726,273	M1415K	probably benign	Het
Glo1	G	A	17: 30,597,861	T107I	possibly damaging	Het
Gm10800	AAAGAAAACTGAA	ACAAGAAAACTGAA	2: 98,667,033		probably null	Het
Gm17334	C	T	11: 53,772,934	V34M	unknown	Het
Gm4981	G	A	10: 58,235,556	L279F	possibly damaging	Het
Habp4	T	A	13: 64,174,801	M228K	probably benign	Het
Hacl1	A	G	14: 31,622,881	V257A	possibly damaging	Het
Ift122	T	G	6: 115,880,667	S125A	possibly damaging	Het
Iqce	C	T	5: 140,666,107	D704N	possibly damaging	Het
Jcad	T	A	18: 4,673,252	L338*	probably null	Het
Kcnj13	T	C	1: 87,389,127	D88G	probably damaging	Het
Kif1b	T	C	4: 149,220,641	D942G	probably damaging	Het
March8	T	A	6: 116,406,276	S271T	probably benign	Het
Meis1	A	G	11: 19,011,378	L165S	probably damaging	Het
Morc2b	T	A	17: 33,136,204	T865S	probably benign	Het
Morc3	T	A	16: 93,844,219	N46K	possibly damaging	Het
Mpzl1	C	T	1: 165,601,805	C219Y	probably benign	Het
Mup5	A	G	4: 61,832,550		probably null	Het
Ninl	A	T	2: 150,949,883	W907R	probably benign	Het
Nol6	A	T	4: 41,120,156	S491T	probably benign	Het
Olfr1276	A	T	2: 111,257,738	I208F	probably benign	Het
Olfr1480	T	A	19: 13,530,333	I264N	probably damaging	Het
Olfr578	A	G	7: 102,985,014	V50A	probably benign	Het
Olfr775	C	A	10: 129,251,313	P260T	possibly damaging	Het
Osbpl6	T	A	2: 76,594,847	M919K	probably benign	Het
Otogl	A	T	10: 107,762,503	V2262E	possibly damaging	Het
Pcbp2	A	G	15: 102,474,678	D77G	possibly damaging	Het
Pcsk7	G	A	9: 45,909,609	R113Q	possibly damaging	Het
Pds5b	T	C	5: 150,722,506	I143T	probably damaging	Het
Polr2m	T	C	9: 71,479,428	E357G	possibly damaging	Het
Prox2	G	A	12: 85,094,992	Q146*	probably null	Het
Ptprt	A	G	2: 161,553,812	V1167A	probably benign	Het
Rbm11	G	A	16: 75,600,655	E158K	possibly damaging	Het
Sar1b	T	A	11: 51,789,237	L130Q	probably damaging	Het
Slc35f6	A	G	5: 30,657,836	N369S	possibly damaging	Het
Slc39a12	A	T	2: 14,407,569	M351L	probably benign	Het
Taf15	T	A	11: 83,504,661	Y397*	probably null	Het
Tmprss11e	A	T	5: 86,727,290	V39D	probably damaging	Het
Trim71	T	C	9: 114,513,291	D641G	probably damaging	Het
Trpc3	T	A	3: 36,640,760	T682S	probably damaging	Het
Tsen54	T	C	11: 115,817,107		probably null	Het
Usp6nl	A	G	2: 6,441,149	N646D	possibly damaging	Het
Vip	T	C	10: 5,640,661	F12L	probably benign	Het
Vmn1r39	A	T	6: 66,804,588	F249I	probably benign	Het
Vmn2r106	A	T	17: 20,285,379	S18T	probably benign	Het
Vmn2r97	G	T	17: 18,929,657	V436L	probably benign	Het
Washc2	T	C	6: 116,260,670		probably null	Het
Ykt6	T	C	11: 5,964,613	V171A	possibly damaging	Het
Zfp658	A	G	7: 43,572,715	D138G	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- GCCTTCATGAGCACAAACTTG -3'
(R):5'- TGTGCAAAAGTATTCGGCAGTG -3'

Sequencing Primer
(F):5'- CTTGTTGAAAGTAGGGAGCCC -3'
(R):5'- TATTCGGCAGTGACAGCG -3'

Posted On

2022-08-09