Incidental Mutation 'R2189:Bsph1'
ID237965
Institutional Source Beutler Lab
Gene Symbol Bsph1
Ensembl Gene ENSMUSG00000074378
Gene Namebinder of sperm protein homolog 1
SynonymsLOC330470
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13450841-13473449 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 13470329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098811] [ENSMUST00000204715]
Predicted Effect probably null
Transcript: ENSMUST00000098811
SMART Domains Protein: ENSMUSP00000096408
Gene: ENSMUSG00000074378

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FN2 39 82 1.36e-6 SMART
FN2 83 131 2.29e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204715
SMART Domains Protein: ENSMUSP00000144997
Gene: ENSMUSG00000074378

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FN2 28 72 3.47e-6 SMART
FN2 73 121 2.29e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the binder of sperm family. The encoded protein may be involved in sperm capacitation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Bsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03131:Bsph1 APN 7 13473087 missense probably damaging 1.00
R0334:Bsph1 UTSW 7 13450939 nonsense probably null
R0684:Bsph1 UTSW 7 13473063 missense probably damaging 1.00
R0701:Bsph1 UTSW 7 13472256 missense probably damaging 1.00
R0905:Bsph1 UTSW 7 13450914 start codon destroyed probably benign 0.33
R1087:Bsph1 UTSW 7 13472181 missense probably damaging 1.00
R3427:Bsph1 UTSW 7 13472243 missense probably damaging 1.00
R4043:Bsph1 UTSW 7 13458276 critical splice donor site probably null
R4718:Bsph1 UTSW 7 13472182 nonsense probably null
R4726:Bsph1 UTSW 7 13472995 missense probably benign 0.00
R5571:Bsph1 UTSW 7 13450915 start codon destroyed probably null 0.86
R6852:Bsph1 UTSW 7 13470330 critical splice donor site probably null
R6903:Bsph1 UTSW 7 13458258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAGGAGCATAAAACTAGATCTGA -3'
(R):5'- TCTGGAATCAGAAGACAATGCAC -3'

Sequencing Primer
(F):5'- TTGAAGCTACACCCAGTGTG -3'
(R):5'- GGGATCAGTTGACAGTACCTATATG -3'
Posted On2014-10-02