Mutagenetix > Incidental Mutations

Incidental Mutation 'R2189:Scap'

237976

Institutional Source

Beutler Lab

Gene Symbol

Scap

Ensembl Gene

ENSMUSG00000032485

Gene Name

SREBF chaperone

Synonyms

MMRRC Submission

040191-MU

Accession Numbers

Genbank: NM_001001144; MGI: 2135958

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2189 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110333288-110384950 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110377693 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 402 (I402N)

Ref Sequence

ENSEMBL: ENSMUSP00000095953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098350] [ENSMUST00000198976]

Predicted Effect

probably damaging
Transcript: ENSMUST00000098350
AA Change: I402N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485
AA Change: I402N

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
low complexity region	43	54	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
Pfam:Patched	279	504	4.7e-24	PFAM
Pfam:Sterol-sensing	308	459	7.6e-54	PFAM
transmembrane domain	515	534	N/A	INTRINSIC
transmembrane domain	711	733	N/A	INTRINSIC
low complexity region	741	751	N/A	INTRINSIC
WD40	765	802	1.79e-1	SMART
low complexity region	847	865	N/A	INTRINSIC
low complexity region	928	944	N/A	INTRINSIC
WD40	953	990	9.86e1	SMART
low complexity region	1050	1060	N/A	INTRINSIC
WD40	1062	1102	4.18e-2	SMART
WD40	1105	1143	5.64e-8	SMART
WD40	1147	1183	2.4e-1	SMART
WD40	1186	1223	2.56e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168137

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196424

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196775

Predicted Effect

probably benign
Transcript: ENSMUST00000198976

SMART Domains

Protein: ENSMUSP00000143369
Gene: ENSMUSG00000032485

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
low complexity region	43	54	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	C	7: 79,098,091	G870A	probably damaging	Het
Adamtsl2	T	C	2: 27,081,738	W12R	probably benign	Het
Bsph1	G	A	7: 13,470,329		probably null	Het
Celsr1	G	T	15: 85,979,230	H1200Q	possibly damaging	Het
Clptm1	A	T	7: 19,637,145	Y355*	probably null	Het
Cry2	T	C	2: 92,411,692	E572G	possibly damaging	Het
Dlk1	G	A	12: 109,455,049		probably null	Het
Eral1	A	G	11: 78,075,831	V201A	probably benign	Het
Esrp1	A	T	4: 11,357,603	M503K	probably benign	Het
Fam83e	G	T	7: 45,722,183	M1I	probably null	Het
Flt4	G	A	11: 49,635,698	A835T	probably benign	Het
Hdac4	T	C	1: 91,975,522	S562G	probably null	Het
Hist1h2bn	A	G	13: 21,754,277	D52G	probably damaging	Het
Icosl	A	G	10: 78,073,925	T235A	possibly damaging	Het
Itga6	A	G	2: 71,825,617	D295G	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lipa	A	T	19: 34,524,799	L15Q	probably benign	Het
Mcc	T	C	18: 44,534,230	E218G	possibly damaging	Het
Mdga2	A	G	12: 66,473,196		probably null	Het
Mmadhc	A	C	2: 50,288,946	C153W	probably damaging	Het
Myh1	A	G	11: 67,221,604	D1799G	probably damaging	Het
Nlrp1b	T	A	11: 71,169,795	Q729L	probably damaging	Het
Ofcc1	T	A	13: 40,180,448	Q389L	probably benign	Het
Olfr1030	A	G	2: 85,984,068	D76G	probably damaging	Het
Olfr469	T	C	7: 107,822,615	I285V	probably benign	Het
Olfr481	A	T	7: 108,081,036	M81L	possibly damaging	Het
Olfr691	A	G	7: 105,337,602	V38A	probably benign	Het
Pml	T	C	9: 58,234,874	N225S	probably benign	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Sgsm2	A	G	11: 74,853,082	L886P	probably damaging	Het
Sugct	T	C	13: 17,662,266	I104V	probably benign	Het
Tmem200c	A	G	17: 68,840,686	Q88R	probably damaging	Het
Tnfrsf1a	T	A	6: 125,357,805	L14Q	probably benign	Het
Tnk2	C	T	16: 32,671,421	L381F	probably damaging	Het
Ubr2	C	T	17: 46,943,364	V1454I	probably benign	Het
V1ra8	A	C	6: 90,202,962	D49A	probably damaging	Het
Vmn2r5	A	C	3: 64,509,593	M48R	probably benign	Het
Yars	A	G	4: 129,206,189	I227V	probably damaging	Het
Zfp850	C	A	7: 27,989,055	R576L	probably benign	Het
Zfpm2	T	A	15: 41,101,183	F223I	possibly damaging	Het

Other mutations in Scap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00581:Scap	APN	9	110376631	missense	probably damaging	1.00
IGL01012:Scap	APN	9	110362420	missense	probably damaging	1.00
IGL01487:Scap	APN	9	110377734	critical splice donor site	probably null
IGL01634:Scap	APN	9	110378789	critical splice donor site	probably null
IGL01725:Scap	APN	9	110381554	unclassified	probably benign
IGL01939:Scap	APN	9	110379481	missense	probably benign	0.02
IGL02106:Scap	APN	9	110381656	unclassified	probably benign
IGL02423:Scap	APN	9	110378617	missense	probably benign	0.02
IGL02487:Scap	APN	9	110378690	missense	probably benign	0.19
IGL02545:Scap	APN	9	110378690	missense	probably benign	0.19
IGL03226:Scap	APN	9	110384267	missense	possibly damaging	0.93
IGL03331:Scap	APN	9	110380236	unclassified	probably null
3-1:Scap	UTSW	9	110372968	intron	probably benign
R0027:Scap	UTSW	9	110379730	missense	probably benign	0.06
R0089:Scap	UTSW	9	110372222	missense	possibly damaging	0.81
R0742:Scap	UTSW	9	110381259	missense	probably damaging	1.00
R1416:Scap	UTSW	9	110384773	missense	probably damaging	1.00
R1785:Scap	UTSW	9	110374055	missense	probably damaging	0.97
R1996:Scap	UTSW	9	110372971	intron	probably benign
R2114:Scap	UTSW	9	110381273	missense	probably damaging	0.99
R2233:Scap	UTSW	9	110381593	missense	probably damaging	0.98
R2234:Scap	UTSW	9	110381593	missense	probably damaging	0.98
R2656:Scap	UTSW	9	110374019	missense	probably damaging	1.00
R3176:Scap	UTSW	9	110374025	missense	probably benign
R3237:Scap	UTSW	9	110379582	missense	probably damaging	0.96
R3276:Scap	UTSW	9	110374025	missense	probably benign
R3623:Scap	UTSW	9	110380203	missense	probably damaging	0.99
R3826:Scap	UTSW	9	110381297	missense	probably benign
R4859:Scap	UTSW	9	110374342	unclassified	probably benign
R4993:Scap	UTSW	9	110378390	missense	probably damaging	1.00
R5052:Scap	UTSW	9	110353152	missense	possibly damaging	0.89
R5330:Scap	UTSW	9	110381633	missense	probably benign	0.00
R5331:Scap	UTSW	9	110381633	missense	probably benign	0.00
R5383:Scap	UTSW	9	110374529	missense	probably damaging	0.99
R5410:Scap	UTSW	9	110374182	unclassified	probably null
R5531:Scap	UTSW	9	110381429	missense	possibly damaging	0.59
R5567:Scap	UTSW	9	110377644	missense	probably damaging	1.00
R5636:Scap	UTSW	9	110380594	missense	probably damaging	0.99
R5637:Scap	UTSW	9	110381572	missense	possibly damaging	0.94
R5859:Scap	UTSW	9	110374047	missense	probably benign	0.14
R5923:Scap	UTSW	9	110383580	missense	probably damaging	0.98
R5945:Scap	UTSW	9	110384596	missense	probably benign	0.00
R5987:Scap	UTSW	9	110381151	missense	probably damaging	1.00
R6075:Scap	UTSW	9	110378777	missense	probably damaging	1.00
R6130:Scap	UTSW	9	110380379	missense	possibly damaging	0.95
R6190:Scap	UTSW	9	110374067	missense	probably benign	0.01
R6567:Scap	UTSW	9	110383562	missense	probably damaging	1.00
R6999:Scap	UTSW	9	110384647	missense	probably damaging	1.00
R7098:Scap	UTSW	9	110372242	missense	possibly damaging	0.89
R7386:Scap	UTSW	9	110373169	missense	probably benign	0.00
R7642:Scap	UTSW	9	110374013	missense	probably damaging	1.00
R7898:Scap	UTSW	9	110384743	missense	possibly damaging	0.74
R7981:Scap	UTSW	9	110384743	missense	possibly damaging	0.74
X0064:Scap	UTSW	9	110377645	missense	probably damaging	1.00
Z1088:Scap	UTSW	9	110372336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCAGTGCACATGGTGGTG -3'
(R):5'- TGGATCCTATCAAAGGCTTGC -3'

Sequencing Primer
(F):5'- ACATGGTGGTGACTCCCTAGAG -3'
(R):5'- CTTGCATGAGATGACAGGACTCC -3'

Posted On

2014-10-02