Incidental Mutation 'R2189:Dlk1'
ID237986
Institutional Source Beutler Lab
Gene Symbol Dlk1
Ensembl Gene ENSMUSG00000040856
Gene Namedelta like non-canonical Notch ligand 1
SynonymspG2, SCP1, ZOG, FA1, Peg9, pref-1, DlkI
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R2189 (G1)
Quality Score210
Status Not validated
Chromosome12
Chromosomal Location109452823-109463336 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 109455049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056110] [ENSMUST00000109841] [ENSMUST00000109842] [ENSMUST00000109843] [ENSMUST00000109844] [ENSMUST00000109846] [ENSMUST00000124293] [ENSMUST00000173539]
Predicted Effect probably null
Transcript: ENSMUST00000056110
SMART Domains Protein: ENSMUSP00000063104
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109841
SMART Domains Protein: ENSMUSP00000105467
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109842
SMART Domains Protein: ENSMUSP00000105468
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109843
SMART Domains Protein: ENSMUSP00000105469
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109844
SMART Domains Protein: ENSMUSP00000105470
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109846
SMART Domains Protein: ENSMUSP00000105472
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124293
SMART Domains Protein: ENSMUSP00000133530
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
EGF 24 54 1.43e-1 SMART
EGF 55 85 1.26e-2 SMART
EGF_CA 87 124 1.77e-6 SMART
EGF 129 167 8.71e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173539
SMART Domains Protein: ENSMUSP00000133430
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173812
SMART Domains Protein: ENSMUSP00000134308
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
SCOP:d1eqga2 2 15 4e-3 SMART
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174539
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygote null mice have reduced fetal growth and 50% lethality 2 days after birth. Survivors are small but have enlarged fat pad masses. Homozygotes for another null allele have abnormal B cell development. Paternally-inherited null alleles phenocopy homozygotes due to maternal imprinting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Dlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Dlk1 UTSW 12 109455513 missense probably damaging 1.00
R0379:Dlk1 UTSW 12 109455059 unclassified probably benign
R1250:Dlk1 UTSW 12 109459818 missense probably damaging 1.00
R1363:Dlk1 UTSW 12 109455504 missense probably damaging 1.00
R1757:Dlk1 UTSW 12 109459687 missense probably damaging 1.00
R1763:Dlk1 UTSW 12 109458119 missense probably damaging 1.00
R1772:Dlk1 UTSW 12 109459759 missense probably damaging 1.00
R2334:Dlk1 UTSW 12 109453688 missense probably damaging 0.96
R3751:Dlk1 UTSW 12 109460313 missense probably benign 0.15
R5256:Dlk1 UTSW 12 109459771 missense probably damaging 1.00
R5268:Dlk1 UTSW 12 109459838 missense probably benign 0.34
R5356:Dlk1 UTSW 12 109455521 missense probably damaging 0.99
R5669:Dlk1 UTSW 12 109460038 missense probably benign 0.04
R5748:Dlk1 UTSW 12 109459972 missense probably benign 0.00
R5992:Dlk1 UTSW 12 109455581 missense probably damaging 1.00
R6076:Dlk1 UTSW 12 109459969 missense probably damaging 0.98
R6539:Dlk1 UTSW 12 109460319 missense probably benign 0.01
R6638:Dlk1 UTSW 12 109460278 missense probably damaging 1.00
R7480:Dlk1 UTSW 12 109455614 missense probably damaging 1.00
R7553:Dlk1 UTSW 12 109454963 missense unknown
R7602:Dlk1 UTSW 12 109455625 critical splice donor site probably null
R8531:Dlk1 UTSW 12 109458140 missense probably null 0.06
X0020:Dlk1 UTSW 12 109459912 missense probably damaging 1.00
X0053:Dlk1 UTSW 12 109460137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCCTACTGTGTGCCAGG -3'
(R):5'- GCAAGACACTCTTCTGATCCCC -3'

Sequencing Primer
(F):5'- CCAGGTTGGTAGGACCCAAG -3'
(R):5'- AGACACTCTTCTGATCCCCCTCTC -3'
Posted On2014-10-02