Incidental Mutation 'R2189:Dlk1'
ID 237986
Institutional Source Beutler Lab
Gene Symbol Dlk1
Ensembl Gene ENSMUSG00000040856
Gene Name delta like non-canonical Notch ligand 1
Synonyms SCP1, pref-1, pG2, Peg9, ZOG, DlkI, FA1
MMRRC Submission 040191-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.659) question?
Stock # R2189 (G1)
Quality Score 210
Status Not validated
Chromosome 12
Chromosomal Location 109418749-109429262 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 109420975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056110] [ENSMUST00000109841] [ENSMUST00000109842] [ENSMUST00000109843] [ENSMUST00000109844] [ENSMUST00000109846] [ENSMUST00000124293] [ENSMUST00000173539]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000056110
SMART Domains Protein: ENSMUSP00000063104
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109841
SMART Domains Protein: ENSMUSP00000105467
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109842
SMART Domains Protein: ENSMUSP00000105468
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109843
SMART Domains Protein: ENSMUSP00000105469
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109844
SMART Domains Protein: ENSMUSP00000105470
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109846
SMART Domains Protein: ENSMUSP00000105472
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124293
SMART Domains Protein: ENSMUSP00000133530
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
EGF 24 54 1.43e-1 SMART
EGF 55 85 1.26e-2 SMART
EGF_CA 87 124 1.77e-6 SMART
EGF 129 167 8.71e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173539
SMART Domains Protein: ENSMUSP00000133430
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174539
Predicted Effect probably benign
Transcript: ENSMUST00000173812
SMART Domains Protein: ENSMUSP00000134308
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
SCOP:d1eqga2 2 15 4e-3 SMART
transmembrane domain 44 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygote null mice have reduced fetal growth and 50% lethality 2 days after birth. Survivors are small but have enlarged fat pad masses. Homozygotes for another null allele have abnormal B cell development. Paternally-inherited null alleles phenocopy homozygotes due to maternal imprinting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 78,747,839 (GRCm39) G870A probably damaging Het
Adamtsl2 T C 2: 26,971,750 (GRCm39) W12R probably benign Het
Bsph1 G A 7: 13,204,254 (GRCm39) probably null Het
Celsr1 G T 15: 85,863,431 (GRCm39) H1200Q possibly damaging Het
Clptm1 A T 7: 19,371,070 (GRCm39) Y355* probably null Het
Cry2 T C 2: 92,242,037 (GRCm39) E572G possibly damaging Het
Eral1 A G 11: 77,966,657 (GRCm39) V201A probably benign Het
Esrp1 A T 4: 11,357,603 (GRCm39) M503K probably benign Het
Fam83e G T 7: 45,371,607 (GRCm39) M1I probably null Het
Flt4 G A 11: 49,526,525 (GRCm39) A835T probably benign Het
H2bc15 A G 13: 21,938,447 (GRCm39) D52G probably damaging Het
Hdac4 T C 1: 91,903,244 (GRCm39) S562G probably null Het
Icosl A G 10: 77,909,759 (GRCm39) T235A possibly damaging Het
Itga6 A G 2: 71,655,961 (GRCm39) D295G probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lipa A T 19: 34,502,199 (GRCm39) L15Q probably benign Het
Mcc T C 18: 44,667,297 (GRCm39) E218G possibly damaging Het
Mdga2 A G 12: 66,519,970 (GRCm39) probably null Het
Mmadhc A C 2: 50,178,958 (GRCm39) C153W probably damaging Het
Myh1 A G 11: 67,112,430 (GRCm39) D1799G probably damaging Het
Nlrp1b T A 11: 71,060,621 (GRCm39) Q729L probably damaging Het
Ofcc1 T A 13: 40,333,924 (GRCm39) Q389L probably benign Het
Or52b2 A G 7: 104,986,809 (GRCm39) V38A probably benign Het
Or5m5 A G 2: 85,814,412 (GRCm39) D76G probably damaging Het
Or5p4 A T 7: 107,680,243 (GRCm39) M81L possibly damaging Het
Or5p50 T C 7: 107,421,822 (GRCm39) I285V probably benign Het
Pml T C 9: 58,142,157 (GRCm39) N225S probably benign Het
Rnf213 A G 11: 119,321,187 (GRCm39) E1215G probably benign Het
Scap T A 9: 110,206,761 (GRCm39) I402N probably damaging Het
Sgsm2 A G 11: 74,743,908 (GRCm39) L886P probably damaging Het
Sugct T C 13: 17,836,851 (GRCm39) I104V probably benign Het
Tmem200c A G 17: 69,147,681 (GRCm39) Q88R probably damaging Het
Tnfrsf1a T A 6: 125,334,768 (GRCm39) L14Q probably benign Het
Tnk2 C T 16: 32,490,239 (GRCm39) L381F probably damaging Het
Ubr2 C T 17: 47,254,290 (GRCm39) V1454I probably benign Het
V1ra8 A C 6: 90,179,944 (GRCm39) D49A probably damaging Het
Vmn2r5 A C 3: 64,417,014 (GRCm39) M48R probably benign Het
Yars1 A G 4: 129,099,982 (GRCm39) I227V probably damaging Het
Zfp850 C A 7: 27,688,480 (GRCm39) R576L probably benign Het
Zfpm2 T A 15: 40,964,579 (GRCm39) F223I possibly damaging Het
Other mutations in Dlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Dlk1 UTSW 12 109,421,439 (GRCm39) missense probably damaging 1.00
R0379:Dlk1 UTSW 12 109,420,985 (GRCm39) unclassified probably benign
R1250:Dlk1 UTSW 12 109,425,744 (GRCm39) missense probably damaging 1.00
R1363:Dlk1 UTSW 12 109,421,430 (GRCm39) missense probably damaging 1.00
R1757:Dlk1 UTSW 12 109,425,613 (GRCm39) missense probably damaging 1.00
R1763:Dlk1 UTSW 12 109,424,045 (GRCm39) missense probably damaging 1.00
R1772:Dlk1 UTSW 12 109,425,685 (GRCm39) missense probably damaging 1.00
R2334:Dlk1 UTSW 12 109,419,614 (GRCm39) missense probably damaging 0.96
R3751:Dlk1 UTSW 12 109,426,239 (GRCm39) missense probably benign 0.15
R5256:Dlk1 UTSW 12 109,425,697 (GRCm39) missense probably damaging 1.00
R5268:Dlk1 UTSW 12 109,425,764 (GRCm39) missense probably benign 0.34
R5356:Dlk1 UTSW 12 109,421,447 (GRCm39) missense probably damaging 0.99
R5669:Dlk1 UTSW 12 109,425,964 (GRCm39) missense probably benign 0.04
R5748:Dlk1 UTSW 12 109,425,898 (GRCm39) missense probably benign 0.00
R5992:Dlk1 UTSW 12 109,421,507 (GRCm39) missense probably damaging 1.00
R6076:Dlk1 UTSW 12 109,425,895 (GRCm39) missense probably damaging 0.98
R6539:Dlk1 UTSW 12 109,426,245 (GRCm39) missense probably benign 0.01
R6638:Dlk1 UTSW 12 109,426,204 (GRCm39) missense probably damaging 1.00
R7480:Dlk1 UTSW 12 109,421,540 (GRCm39) missense probably damaging 1.00
R7553:Dlk1 UTSW 12 109,420,889 (GRCm39) missense unknown
R7602:Dlk1 UTSW 12 109,421,551 (GRCm39) critical splice donor site probably null
R8531:Dlk1 UTSW 12 109,424,066 (GRCm39) missense probably null 0.06
R9120:Dlk1 UTSW 12 109,424,051 (GRCm39) missense probably benign 0.00
R9554:Dlk1 UTSW 12 109,420,889 (GRCm39) missense unknown
X0020:Dlk1 UTSW 12 109,425,838 (GRCm39) missense probably damaging 1.00
X0053:Dlk1 UTSW 12 109,426,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCCTACTGTGTGCCAGG -3'
(R):5'- GCAAGACACTCTTCTGATCCCC -3'

Sequencing Primer
(F):5'- CCAGGTTGGTAGGACCCAAG -3'
(R):5'- AGACACTCTTCTGATCCCCCTCTC -3'
Posted On 2014-10-02