Incidental Mutation 'R2189:Itga6'
ID237954
Institutional Source Beutler Lab
Gene Symbol Itga6
Ensembl Gene ENSMUSG00000027111
Gene Nameintegrin alpha 6
SynonymsCd49f, 5033401O05Rik
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71745616-71858416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71825617 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 295 (D295G)
Ref Sequence ENSEMBL: ENSMUSP00000107729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028522] [ENSMUST00000112101]
Predicted Effect probably benign
Transcript: ENSMUST00000028522
AA Change: D295G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028522
Gene: ENSMUSG00000027111
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 5e-32 SMART
SCOP:d1m1xa3 797 1017 3e-55 SMART
Pfam:Integrin_alpha 1038 1052 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112101
AA Change: D295G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107729
Gene: ENSMUSG00000027111
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 4e-32 SMART
SCOP:d1m1xa3 797 1017 4e-55 SMART
low complexity region 1058 1070 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152009
Predicted Effect probably benign
Transcript: ENSMUST00000155249
SMART Domains Protein: ENSMUSP00000118086
Gene: ENSMUSG00000027111

DomainStartEndE-ValueType
Pfam:Integrin_alpha2 58 533 4.7e-131 PFAM
transmembrane domain 609 631 N/A INTRINSIC
Pfam:Integrin_alpha 632 646 6.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 4 to bind laminin and to form the main component of hemidesmosomes, which mediate attachment of epithelia to basement membranes. In mouse, deficiency of this gene is associated with absence of hemidesmosomes, severe skin blistering, and early post-natal death. In humans mutations of this gene are associated with epidermolysis bullosa. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe blistering of the skin and other epithelia, absence of hemidesmosomes, altered laminin deposition in brain, and ectopic neuroblastic outgrowths on the brain and in the eye. Mutants die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Itga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Itga6 APN 2 71838262 splice site probably null
IGL00902:Itga6 APN 2 71849394 missense probably benign 0.39
IGL01360:Itga6 APN 2 71787326 splice site probably null
IGL01621:Itga6 APN 2 71825656 missense probably benign 0.02
IGL01877:Itga6 APN 2 71838280 missense probably benign
IGL02332:Itga6 APN 2 71838373 missense possibly damaging 0.63
IGL02556:Itga6 APN 2 71838683 missense probably benign 0.20
IGL02713:Itga6 APN 2 71816713 missense possibly damaging 0.79
IGL02811:Itga6 APN 2 71826732 missense probably damaging 0.98
IGL03171:Itga6 APN 2 71841329 critical splice donor site probably null
isle_royale UTSW 2 71787233 missense probably benign 0.04
PIT4418001:Itga6 UTSW 2 71834070 missense probably benign 0.06
R0070:Itga6 UTSW 2 71826716 unclassified probably benign
R0611:Itga6 UTSW 2 71820060 missense possibly damaging 0.84
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1439:Itga6 UTSW 2 71834034 missense probably damaging 1.00
R1487:Itga6 UTSW 2 71843240 missense possibly damaging 0.87
R1713:Itga6 UTSW 2 71787202 missense probably benign
R1720:Itga6 UTSW 2 71820166 missense probably damaging 1.00
R1816:Itga6 UTSW 2 71840809 missense probably benign 0.00
R1866:Itga6 UTSW 2 71834070 missense probably benign
R2009:Itga6 UTSW 2 71816681 missense probably benign 0.26
R2018:Itga6 UTSW 2 71818484 missense probably benign 0.16
R2171:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R2289:Itga6 UTSW 2 71818529 missense probably damaging 0.99
R2399:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R4437:Itga6 UTSW 2 71825638 missense probably benign 0.42
R4482:Itga6 UTSW 2 71855915 missense probably damaging 1.00
R4773:Itga6 UTSW 2 71822444 missense probably benign 0.13
R4786:Itga6 UTSW 2 71838690 missense possibly damaging 0.80
R4898:Itga6 UTSW 2 71838373 missense possibly damaging 0.77
R5074:Itga6 UTSW 2 71826435 missense probably benign
R5386:Itga6 UTSW 2 71841150 missense probably damaging 1.00
R5591:Itga6 UTSW 2 71840590 missense probably damaging 1.00
R6024:Itga6 UTSW 2 71787233 missense probably benign 0.04
R6174:Itga6 UTSW 2 71833709 missense possibly damaging 0.88
R6210:Itga6 UTSW 2 71834007 critical splice acceptor site probably null
R6432:Itga6 UTSW 2 71833772 missense possibly damaging 0.75
R6644:Itga6 UTSW 2 71841124 missense probably damaging 1.00
R7354:Itga6 UTSW 2 71820230 missense probably damaging 1.00
R7402:Itga6 UTSW 2 71853553 missense probably benign 0.05
R7479:Itga6 UTSW 2 71838336 nonsense probably null
R7635:Itga6 UTSW 2 71843233 missense probably benign 0.00
R7657:Itga6 UTSW 2 71846251 missense probably benign 0.40
R7737:Itga6 UTSW 2 71822443 missense probably benign 0.38
R7782:Itga6 UTSW 2 71841535 missense probably damaging 0.98
R8062:Itga6 UTSW 2 71841743 missense probably benign 0.11
R8312:Itga6 UTSW 2 71855953 missense probably benign
R8698:Itga6 UTSW 2 71843274 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTGGTGTAGCCCTTTGC -3'
(R):5'- AGTCCCTTCTCTAGACCTACGG -3'

Sequencing Primer
(F):5'- GCACTATGACTCCTGTAGTAAATGTG -3'
(R):5'- CTACGGAAGGCAGCCATCAG -3'
Posted On2014-10-02