Incidental Mutation 'R2216:Slc4a9'
ID241189
Institutional Source Beutler Lab
Gene Symbol Slc4a9
Ensembl Gene ENSMUSG00000024485
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 9
SynonymsAE4, D630024F24Rik
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36528157-36541293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36530745 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 274 (H274R)
Ref Sequence ENSEMBL: ENSMUSP00000111358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074298] [ENSMUST00000115694]
Predicted Effect probably benign
Transcript: ENSMUST00000074298
AA Change: H274R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073910
Gene: ENSMUSG00000024485
AA Change: H274R

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 174 4.6e-19 PFAM
Pfam:Band_3_cyto 161 300 7.1e-45 PFAM
Pfam:HCO3_cotransp 367 788 2.7e-168 PFAM
transmembrane domain 794 816 N/A INTRINSIC
low complexity region 830 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115694
AA Change: H274R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111358
Gene: ENSMUSG00000024485
AA Change: H274R

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 170 1.9e-15 PFAM
Pfam:Band_3_cyto 159 300 1e-38 PFAM
Pfam:HCO3_cotransp 349 805 3.1e-174 PFAM
Pfam:HCO3_cotransp 801 837 1.1e-11 PFAM
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 879 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in anion exchange. Expression of this gene is mostly limited to the kidney. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered ion exchange in intestinal epithelia and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Tnnt3 A G 7: 142,512,564 Y222C probably benign Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Slc4a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc4a9 APN 18 36539596 splice site probably benign
IGL01890:Slc4a9 APN 18 36529707 missense possibly damaging 0.63
IGL01995:Slc4a9 APN 18 36539775 missense possibly damaging 0.64
IGL02293:Slc4a9 APN 18 36533215 missense probably benign 0.00
IGL02476:Slc4a9 APN 18 36535445 critical splice donor site probably null
IGL02690:Slc4a9 APN 18 36531987 missense probably damaging 1.00
IGL02726:Slc4a9 APN 18 36539617 missense probably benign 0.24
IGL03003:Slc4a9 APN 18 36536893 missense probably damaging 1.00
IGL03344:Slc4a9 APN 18 36535601 missense probably damaging 1.00
IGL03410:Slc4a9 APN 18 36529687 missense probably benign
R0025:Slc4a9 UTSW 18 36531666 splice site probably benign
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0330:Slc4a9 UTSW 18 36535539 missense probably damaging 1.00
R0457:Slc4a9 UTSW 18 36535418 missense probably damaging 1.00
R0831:Slc4a9 UTSW 18 36535278 splice site probably benign
R0989:Slc4a9 UTSW 18 36536867 nonsense probably null
R1016:Slc4a9 UTSW 18 36531425 missense probably benign 0.12
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1598:Slc4a9 UTSW 18 36528371 nonsense probably null
R1710:Slc4a9 UTSW 18 36532022 missense probably benign
R2041:Slc4a9 UTSW 18 36530793 missense possibly damaging 0.93
R3899:Slc4a9 UTSW 18 36535563 missense probably benign 0.09
R5236:Slc4a9 UTSW 18 36530847 missense probably benign
R5902:Slc4a9 UTSW 18 36529333 splice site probably null
R5902:Slc4a9 UTSW 18 36531507 missense probably damaging 1.00
R5978:Slc4a9 UTSW 18 36535403 missense probably damaging 1.00
R6438:Slc4a9 UTSW 18 36535687 missense probably benign 0.00
R6452:Slc4a9 UTSW 18 36531459 missense probably damaging 1.00
R7238:Slc4a9 UTSW 18 36529720 missense probably benign 0.00
R7329:Slc4a9 UTSW 18 36540821 missense possibly damaging 0.76
R7409:Slc4a9 UTSW 18 36530805 missense probably damaging 0.99
R7649:Slc4a9 UTSW 18 36528377 missense probably benign 0.16
R7694:Slc4a9 UTSW 18 36536849 missense probably damaging 0.99
R7856:Slc4a9 UTSW 18 36528698 missense probably benign 0.04
R8523:Slc4a9 UTSW 18 36532143 missense possibly damaging 0.91
Z1177:Slc4a9 UTSW 18 36531428 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTGAAGTTTCCAGTTCACTG -3'
(R):5'- CCATAATCAAGGTGAAGATCGGC -3'

Sequencing Primer
(F):5'- TTCACTGCTGGCCCAAGGTAG -3'
(R):5'- TCGGCATGGAATTAAGCCC -3'
Posted On2014-10-15