Mutagenetix > Incidental Mutations

Incidental Mutation 'R2336:Vmn2r106'

246570

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r106

Ensembl Gene

ENSMUSG00000091656

Gene Name

vomeronasal 2, receptor 106

Synonyms

EG224576

MMRRC Submission

040323-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R2336 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20267547-20285430 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20268208 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 643 (N643S)

Ref Sequence

ENSEMBL: ENSMUSP00000126534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167464]

Predicted Effect

probably benign
Transcript: ENSMUST00000167464
AA Change: N643S

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000126534
Gene: ENSMUSG00000091656
AA Change: N643S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	471	3.8e-37	PFAM
Pfam:NCD3G	514	567	5.7e-22	PFAM
Pfam:7tm_3	596	835	1.3e-49	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	T	A	1: 181,227,641		noncoding transcript	Het
Arhgap21	G	A	2: 20,880,051	R772C	probably damaging	Het
Arid2	A	G	15: 96,362,549	E393G	probably damaging	Het
Atrn	C	T	2: 130,957,954	T417I	probably damaging	Het
Baiap3	T	C	17: 25,250,404	K173R	probably damaging	Het
Bdp1	A	T	13: 100,053,002	N1497K	probably damaging	Het
Ceacam5	T	C	7: 17,747,375	V349A	probably benign	Het
Chrnd	T	C	1: 87,194,893	F132S	probably damaging	Het
Ddx42	A	G	11: 106,231,150	M164V	possibly damaging	Het
Dtwd2	A	G	18: 49,700,253		probably benign	Het
Eprs	T	A	1: 185,411,374		probably benign	Het
Fut8	A	G	12: 77,412,956		probably benign	Het
Gabrr3	C	T	16: 59,429,950	T104M	probably damaging	Het
Gcat	G	A	15: 79,030,980	R16H	probably benign	Het
Gnb2	A	T	5: 137,529,198	W125R	probably damaging	Het
Grik4	C	T	9: 42,566,355	D512N	probably damaging	Het
Hnf4g	T	C	3: 3,641,224	F60L	probably benign	Het
Lrp6	A	G	6: 134,507,583	I359T	probably damaging	Het
Lrrfip2	A	G	9: 111,222,215	D325G	probably damaging	Het
Mttp	A	T	3: 138,116,095	I222K	possibly damaging	Het
Myom1	A	T	17: 71,023,194	H107L	possibly damaging	Het
Olfr120	A	T	17: 37,726,798	Y258F	probably benign	Het
Olfr458	A	G	6: 42,460,729	C97R	probably damaging	Het
Ppfia3	T	C	7: 45,356,697		probably null	Het
Prokr2	A	T	2: 132,381,439	M61K	probably damaging	Het
Ptk2	A	G	15: 73,266,116	C502R	probably damaging	Het
Rbm25	T	A	12: 83,651,418	W172R	probably damaging	Het
Rdh16f1	A	G	10: 127,788,755	K154R	probably benign	Het
Rnf213	G	A	11: 119,414,604	E554K	probably benign	Het
Rnf219	G	A	14: 104,478,882	P685L	probably damaging	Het
St3gal6	A	T	16: 58,493,704	I22K	probably damaging	Het
Usp43	G	A	11: 67,891,432	R387*	probably null	Het
Zcchc6	G	T	13: 59,799,054	P585Q	probably damaging	Het
Zdbf2	G	T	1: 63,303,464	R334L	probably benign	Het
Zfp868	G	T	8: 69,613,907		probably null	Het

Other mutations in Vmn2r106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Vmn2r106	APN	17	20277575	missense	possibly damaging	0.90
IGL01313:Vmn2r106	APN	17	20278389	missense	probably damaging	0.99
IGL01419:Vmn2r106	APN	17	20279545	missense	probably benign	0.06
IGL01574:Vmn2r106	APN	17	20268310	missense	possibly damaging	0.94
IGL01796:Vmn2r106	APN	17	20268052	missense	possibly damaging	0.79
IGL01893:Vmn2r106	APN	17	20277468	missense	probably benign	0.06
IGL01895:Vmn2r106	APN	17	20278965	missense	probably benign	0.02
IGL02378:Vmn2r106	APN	17	20277529	missense	probably damaging	1.00
IGL02430:Vmn2r106	APN	17	20278896	missense	probably benign	0.38
IGL02664:Vmn2r106	APN	17	20268082	missense	possibly damaging	0.88
IGL03308:Vmn2r106	APN	17	20278523	nonsense	probably null
IGL03384:Vmn2r106	APN	17	20268143	missense	probably damaging	0.99
R0401:Vmn2r106	UTSW	17	20279019	missense	possibly damaging	0.86
R0842:Vmn2r106	UTSW	17	20268203	missense	probably damaging	1.00
R0964:Vmn2r106	UTSW	17	20267597	missense	probably benign	0.00
R1235:Vmn2r106	UTSW	17	20279479	missense	probably benign	0.00
R1709:Vmn2r106	UTSW	17	20279111	missense	probably benign	0.12
R1712:Vmn2r106	UTSW	17	20278735	missense	probably benign	0.01
R1770:Vmn2r106	UTSW	17	20268298	missense	probably damaging	0.99
R2049:Vmn2r106	UTSW	17	20268304	missense	possibly damaging	0.90
R2245:Vmn2r106	UTSW	17	20268161	missense	probably benign	0.13
R2910:Vmn2r106	UTSW	17	20278684	missense	probably damaging	1.00
R3025:Vmn2r106	UTSW	17	20278885	missense	probably benign	0.00
R3944:Vmn2r106	UTSW	17	20267651	missense	probably damaging	1.00
R4081:Vmn2r106	UTSW	17	20267556	nonsense	probably null
R4153:Vmn2r106	UTSW	17	20267818	missense	probably damaging	1.00
R4356:Vmn2r106	UTSW	17	20279648	missense	probably benign	0.06
R4426:Vmn2r106	UTSW	17	20285379	missense	probably benign	0.00
R4590:Vmn2r106	UTSW	17	20277466	missense	probably damaging	0.99
R4661:Vmn2r106	UTSW	17	20267623	missense	probably benign	0.10
R5106:Vmn2r106	UTSW	17	20279133	critical splice acceptor site	probably null
R5341:Vmn2r106	UTSW	17	20277526	missense	probably benign	0.00
R5509:Vmn2r106	UTSW	17	20278422	missense	probably damaging	0.99
R5826:Vmn2r106	UTSW	17	20278871	missense	probably benign
R5859:Vmn2r106	UTSW	17	20285321	missense	possibly damaging	0.72
R5937:Vmn2r106	UTSW	17	20285405	nonsense	probably null
R5972:Vmn2r106	UTSW	17	20278476	missense	probably benign
R6056:Vmn2r106	UTSW	17	20267544	splice site	probably null
R6108:Vmn2r106	UTSW	17	20268376	missense	probably benign	0.11
R6114:Vmn2r106	UTSW	17	20268376	missense	probably benign	0.11
R6115:Vmn2r106	UTSW	17	20268376	missense	probably benign	0.11
R6132:Vmn2r106	UTSW	17	20268404	missense	probably benign
R6208:Vmn2r106	UTSW	17	20268329	missense	probably damaging	0.99
R6217:Vmn2r106	UTSW	17	20268239	missense	probably benign	0.10
R6289:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6378:Vmn2r106	UTSW	17	20278405	missense	probably benign	0.19
R6390:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6391:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6392:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6405:Vmn2r106	UTSW	17	20279099	missense	probably benign	0.22
R6427:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6428:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6435:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6436:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6437:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6511:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6512:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6587:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6703:Vmn2r106	UTSW	17	20268463	missense	probably damaging	1.00
R6730:Vmn2r106	UTSW	17	20278834	missense	possibly damaging	0.64
R6961:Vmn2r106	UTSW	17	20268384	nonsense	probably null
R7054:Vmn2r106	UTSW	17	20278920	missense	probably damaging	0.96
R7379:Vmn2r106	UTSW	17	20267775	missense	possibly damaging	0.75
R7402:Vmn2r106	UTSW	17	20267621	missense	probably damaging	0.99
R7497:Vmn2r106	UTSW	17	20267939	missense	probably damaging	1.00
R7692:Vmn2r106	UTSW	17	20285228	missense	possibly damaging	0.96
R8539:Vmn2r106	UTSW	17	20279009	missense	probably benign	0.00
R8827:Vmn2r106	UTSW	17	20267606	missense	probably benign	0.05
R8872:Vmn2r106	UTSW	17	20268139	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- AGGAATGATGTAGTTTGGGACCC -3'
(R):5'- TCACTGCTTCCAGAAAACTGTG -3'

Sequencing Primer
(F):5'- GGGACCCTTGACATCATTAGC -3'
(R):5'- TGGCCTATGAAGACCCCTTG -3'

Posted On

2014-10-30