Mutagenetix > Incidental Mutation

Incidental Mutation 'R2495:Taf3'

250917

Institutional Source

Beutler Lab

Gene Symbol

Taf3

Ensembl Gene

ENSMUSG00000025782

Gene Name

TATA-box binding protein associated factor 3

Synonyms

mTAFII140, 4933439M23Rik

MMRRC Submission

040409-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R2495 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9914552-10048596 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 9952833 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 174 (N174K)

Ref Sequence

ENSEMBL: ENSMUSP00000026888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026888] [ENSMUST00000114909]

AlphaFold

Q5HZG4

PDB Structure

Solution structure of the free TAF3 PHD domain [SOLUTION NMR]
Solution structure of the TAF3 PHD domain in complex with a H3K4me3 peptide [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026888
AA Change: N174K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026888
Gene: ENSMUSG00000025782
AA Change: N174K

Domain	Start	End	E-Value	Type
BTP	3	79	1.94e-34	SMART
low complexity region	159	173	N/A	INTRINSIC
low complexity region	237	253	N/A	INTRINSIC
low complexity region	306	325	N/A	INTRINSIC
low complexity region	404	423	N/A	INTRINSIC
low complexity region	447	461	N/A	INTRINSIC
low complexity region	487	505	N/A	INTRINSIC
coiled coil region	519	572	N/A	INTRINSIC
coiled coil region	611	651	N/A	INTRINSIC
coiled coil region	692	751	N/A	INTRINSIC
low complexity region	779	790	N/A	INTRINSIC
low complexity region	795	821	N/A	INTRINSIC
low complexity region	826	837	N/A	INTRINSIC
PHD	869	915	4.77e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114909
AA Change: N21K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110559
Gene: ENSMUSG00000025782
AA Change: N21K

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
low complexity region	84	100	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	251	270	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
low complexity region	334	352	N/A	INTRINSIC
coiled coil region	366	419	N/A	INTRINSIC
coiled coil region	458	498	N/A	INTRINSIC
coiled coil region	539	598	N/A	INTRINSIC
low complexity region	626	637	N/A	INTRINSIC
low complexity region	642	668	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
PHD	716	762	4.77e-11	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]).[supplied by OMIM, May 2009]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,481,960	F125S	unknown	Het
Abhd17c	C	T	7: 84,110,676	W290*	probably null	Het
Acsl5	A	T	19: 55,293,599	K536*	probably null	Het
Adamts14	A	T	10: 61,198,970		probably null	Het
Agbl3	A	G	6: 34,846,764	H788R	probably damaging	Het
Agrp	T	C	8: 105,566,776	N126D	possibly damaging	Het
Ambn	T	C	5: 88,467,804	I349T	probably benign	Het
Ank1	T	C	8: 23,132,264	W1610R	probably damaging	Het
Aox3	T	C	1: 58,188,408	L1224P	probably damaging	Het
Arhgef28	A	T	13: 98,029,373		probably benign	Het
Bcl11b	G	A	12: 107,915,447	H798Y	possibly damaging	Het
Capn11	T	A	17: 45,638,763	M426L	probably damaging	Het
Cep95	A	G	11: 106,809,282	K290E	possibly damaging	Het
Cic	A	G	7: 25,291,776		probably benign	Het
Cnbd1	A	T	4: 18,860,579	M389K	probably damaging	Het
Cnksr1	A	T	4: 134,232,162	L387Q	probably benign	Het
Cntrob	G	T	11: 69,322,923	P14T	probably damaging	Het
Crmp1	G	A	5: 37,246,097		probably null	Het
Dido1	A	G	2: 180,689,388	V89A	probably benign	Het
Dnah7a	T	A	1: 53,605,881	I999F	probably damaging	Het
Dsp	T	A	13: 38,193,477	L1746Q	possibly damaging	Het
Dst	T	C	1: 34,199,373	S3897P	probably damaging	Het
Fbxo10	A	G	4: 45,040,545	F887L	probably benign	Het
Gm21961	T	A	15: 65,014,873	H11L	unknown	Het
Gm4559	A	T	7: 142,273,820	C182S	unknown	Het
Gm5724	C	A	6: 141,765,777	M69I	probably benign	Het
Golga3	T	A	5: 110,207,596	S939T	probably damaging	Het
Got2	A	G	8: 95,888,290	S6P	possibly damaging	Het
Gpatch8	A	T	11: 102,478,481	H1410Q	probably damaging	Het
Gpx5	T	A	13: 21,291,440	T39S	probably benign	Het
Grin2b	T	C	6: 135,733,182	Y1122C	probably damaging	Het
Gsn	A	C	2: 35,303,193	N538T	probably damaging	Het
Helz2	A	G	2: 181,232,912	S1930P	probably damaging	Het
Krt6b	A	T	15: 101,678,322	F286Y	probably damaging	Het
Lrriq1	G	A	10: 103,202,381	R854C	probably damaging	Het
Mipol1	A	T	12: 57,460,990		probably benign	Het
Mmp19	A	G	10: 128,790,950		probably benign	Het
Msc	T	G	1: 14,755,249	Y167S	probably benign	Het
Mycbp2	T	G	14: 103,200,118	K2103Q	probably damaging	Het
Myh11	C	A	16: 14,205,557	D1586Y	probably damaging	Het
Nol6	A	T	4: 41,118,427	D791E	probably damaging	Het
Pcm1	A	G	8: 41,293,579	T1272A	probably benign	Het
Phgdh	A	G	3: 98,339,789	L15P	probably damaging	Het
Ptprk	A	T	10: 28,475,078		probably benign	Het
Ralgapa2	G	T	2: 146,361,400	D1091E	possibly damaging	Het
Rbbp8nl	C	A	2: 180,279,102	K496N	probably null	Het
Rbm26	T	C	14: 105,151,312		probably benign	Het
Rfx6	A	C	10: 51,726,675		probably benign	Het
Rras	G	A	7: 45,018,064	G17R	probably damaging	Het
Shisa6	G	A	11: 66,217,633	P473S	probably damaging	Het
Slc9a3	A	G	13: 74,158,703	K316E	probably damaging	Het
Spata31d1a	A	G	13: 59,701,993	S774P	possibly damaging	Het
Spsb4	T	C	9: 96,995,787	Y161C	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Trnt1	T	A	6: 106,773,369	V78E	possibly damaging	Het
Ubox5	A	T	2: 130,599,521	C415*	probably null	Het
Ucn2	C	T	9: 108,986,409	P80S	possibly damaging	Het
Vmn2r10	G	A	5: 108,996,095	T663I	probably damaging	Het
Wdfy1	A	T	1: 79,707,505	F337L	probably null	Het
Zfp287	A	T	11: 62,714,633	C483S	probably damaging	Het
Zyg11b	A	G	4: 108,244,724		probably null	Het

Other mutations in Taf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Taf3	APN	2	9952917	missense	probably damaging	1.00
IGL01620:Taf3	APN	2	9952661	missense	probably benign	0.00
IGL02084:Taf3	APN	2	10042519	missense	probably benign	0.08
IGL02229:Taf3	APN	2	9952834	missense	probably damaging	1.00
IGL02891:Taf3	APN	2	9921227	missense	probably damaging	1.00
IGL03173:Taf3	APN	2	9952927	missense	probably damaging	0.99
IGL03302:Taf3	APN	2	9952131	missense	probably damaging	1.00
Bathtub	UTSW	2	9951658	missense	possibly damaging	0.89
Howard	UTSW	2	9951160	missense	probably damaging	0.99
President	UTSW	2	9951353	missense	probably damaging	0.98
R0344:Taf3	UTSW	2	9951898	missense	probably benign	0.05
R0348:Taf3	UTSW	2	10042644	missense	probably benign	0.05
R0506:Taf3	UTSW	2	9940993	missense	probably benign	0.00
R1724:Taf3	UTSW	2	9952366	missense	probably benign	0.01
R2151:Taf3	UTSW	2	9951566	missense	possibly damaging	0.82
R2154:Taf3	UTSW	2	9951566	missense	possibly damaging	0.82
R3702:Taf3	UTSW	2	9952561	missense	possibly damaging	0.74
R3739:Taf3	UTSW	2	9951658	missense	possibly damaging	0.89
R3921:Taf3	UTSW	2	10048298	missense	probably benign	0.06
R4097:Taf3	UTSW	2	9952367	missense	possibly damaging	0.54
R4602:Taf3	UTSW	2	9952657	missense	probably damaging	0.96
R4615:Taf3	UTSW	2	9952090	missense	probably damaging	1.00
R4679:Taf3	UTSW	2	10048564	utr 5 prime	probably benign
R4789:Taf3	UTSW	2	9951959	missense	probably damaging	1.00
R4801:Taf3	UTSW	2	9951123	missense	possibly damaging	0.72
R4802:Taf3	UTSW	2	9951123	missense	possibly damaging	0.72
R5201:Taf3	UTSW	2	9952184	missense	probably damaging	1.00
R5522:Taf3	UTSW	2	9941005	missense	probably damaging	1.00
R5629:Taf3	UTSW	2	9918178	missense	probably damaging	1.00
R6427:Taf3	UTSW	2	9951353	missense	probably damaging	0.98
R6492:Taf3	UTSW	2	9951160	missense	probably damaging	0.99
R6804:Taf3	UTSW	2	9918217	missense	possibly damaging	0.91
R7282:Taf3	UTSW	2	9951442	missense	probably damaging	0.96
R7293:Taf3	UTSW	2	9952090	missense	probably damaging	0.98
R7368:Taf3	UTSW	2	9916377	missense	unknown
R7637:Taf3	UTSW	2	9940993	missense	probably benign	0.00
R7686:Taf3	UTSW	2	9951488	missense	probably damaging	1.00
R8251:Taf3	UTSW	2	9918151	missense	possibly damaging	0.92
R9167:Taf3	UTSW	2	9940993	missense	probably benign	0.00
R9402:Taf3	UTSW	2	9951112	critical splice donor site	probably null
R9621:Taf3	UTSW	2	9918259	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTGCAAATGGAGCCAGCATG -3'
(R):5'- GAAGTGATGTTTGAAGACTAGGTTC -3'

Sequencing Primer
(F):5'- AGATCAGCCCTGTCCTGGAC -3'
(R):5'- AAGACTAGGTTCTGTTTGTTGTATCC -3'

Posted On

2014-12-04