Incidental Mutation 'R7789:Smchd1'
ID 628636
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 045845-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R7789 (G1)
Quality Score 49.0072
Status Validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) G to A at 71782296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably benign
Transcript: ENSMUST00000127430
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,682,175 (GRCm39) E163K probably benign Het
Adam34 T A 8: 44,105,488 (GRCm39) R52S probably benign Het
Adcy8 A T 15: 64,743,623 (GRCm39) C328* probably null Het
Ankrd26 G T 6: 118,504,760 (GRCm39) S716R possibly damaging Het
Ankrd26 G T 6: 118,504,759 (GRCm39) H717N probably damaging Het
Ankrd40 C A 11: 94,225,535 (GRCm39) P189T probably damaging Het
Anln A G 9: 22,263,333 (GRCm39) S113P Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Asxl1 C T 2: 153,241,943 (GRCm39) T832I probably benign Het
Bicd2 C T 13: 49,533,135 (GRCm39) R574C probably damaging Het
Boll T C 1: 55,399,826 (GRCm39) probably null Het
Casr A G 16: 36,315,653 (GRCm39) F806L probably damaging Het
Casz1 C A 4: 149,013,863 (GRCm39) N142K probably benign Het
Cbl C T 9: 44,074,764 (GRCm39) D433N probably damaging Het
Ceacam14 T A 7: 17,548,096 (GRCm39) V62D probably damaging Het
Chst10 T C 1: 38,923,532 (GRCm39) N18S probably benign Het
Cyp2j6 C T 4: 96,433,953 (GRCm39) R119H probably benign Het
Cyp4a14 C G 4: 115,352,107 (GRCm39) V102L probably benign Het
Dnajb3 A T 1: 88,133,399 (GRCm39) M1K probably null Het
Dnajc6 A T 4: 101,475,729 (GRCm39) K534M possibly damaging Het
Dnase2a T C 8: 85,635,505 (GRCm39) probably null Het
Dock10 A G 1: 80,536,930 (GRCm39) I985T possibly damaging Het
Emsy G T 7: 98,270,696 (GRCm39) P436Q probably damaging Het
Enpp1 A T 10: 24,529,981 (GRCm39) probably null Het
Erc1 T A 6: 119,750,670 (GRCm39) R353* probably null Het
Fbn2 T A 18: 58,172,385 (GRCm39) D2140V probably benign Het
Fgfr1 T A 8: 26,052,329 (GRCm39) Y218* probably null Het
Fhod1 C T 8: 106,056,740 (GRCm39) R1045H probably damaging Het
Focad G T 4: 88,147,643 (GRCm39) L427F unknown Het
Gbf1 T A 19: 46,242,441 (GRCm39) L144M probably damaging Het
Glmn T G 5: 107,696,941 (GRCm39) N592T probably benign Het
Golgb1 C G 16: 36,695,761 (GRCm39) P87A unknown Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Insyn2b T A 11: 34,352,537 (GRCm39) M193K probably benign Het
Itga9 T G 9: 118,487,564 (GRCm39) F216V possibly damaging Het
Klhl18 T C 9: 110,268,076 (GRCm39) D149G unknown Het
Lcat C T 8: 106,668,857 (GRCm39) V114M probably benign Het
Lrrc8c C A 5: 105,755,066 (GRCm39) N280K probably damaging Het
Mettl8 T C 2: 70,796,806 (GRCm39) Y283C probably damaging Het
Mgat4a A T 1: 37,529,360 (GRCm39) I173K probably damaging Het
Mmp1a T C 9: 7,475,266 (GRCm39) V345A possibly damaging Het
Mok T A 12: 110,778,261 (GRCm39) H215L probably damaging Het
Mphosph9 C G 5: 124,453,650 (GRCm39) E221Q probably damaging Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Myom1 A G 17: 71,424,431 (GRCm39) T1525A probably benign Het
Nap1l1 C T 10: 111,326,317 (GRCm39) S143L probably benign Het
Or1af1 C T 2: 37,109,672 (GRCm39) T57I probably benign Het
Or2j6 A T 7: 139,980,610 (GRCm39) Y116* probably null Het
Or52d1 T A 7: 103,756,195 (GRCm39) S236R probably damaging Het
Or7g29 G T 9: 19,286,361 (GRCm39) T272K probably benign Het
Plbd2 T C 5: 120,623,819 (GRCm39) S568G probably damaging Het
Plxna4 T A 6: 32,183,168 (GRCm39) probably null Het
Plxnc1 T A 10: 94,630,339 (GRCm39) E1520V probably damaging Het
Ppil3 G A 1: 58,473,538 (GRCm39) T104I possibly damaging Het
Ptprm A T 17: 67,402,534 (GRCm39) V118E probably damaging Het
Rimbp2 T C 5: 128,851,399 (GRCm39) D849G probably damaging Het
Rnf213 T C 11: 119,361,045 (GRCm39) probably null Het
Sema3f T A 9: 107,582,631 (GRCm39) K37N probably benign Het
Sh3glb1 G T 3: 144,397,892 (GRCm39) probably null Het
Sh3rf3 A G 10: 58,922,637 (GRCm39) D571G probably benign Het
Sipa1l3 T C 7: 29,077,150 (GRCm39) Y874C probably damaging Het
Snrnp70 A T 7: 45,026,045 (GRCm39) Y441* probably null Het
Ssrp1 C T 2: 84,871,525 (GRCm39) R316W probably damaging Het
Syt10 A T 15: 89,711,101 (GRCm39) V144E probably damaging Het
Tdrd12 A G 7: 35,188,117 (GRCm39) L562P Het
Trim68 T C 7: 102,333,676 (GRCm39) D2G possibly damaging Het
Trub2 T A 2: 29,667,920 (GRCm39) H240L probably damaging Het
Tssc4 A G 7: 142,623,515 (GRCm39) probably null Het
Usp7 T A 16: 8,516,675 (GRCm39) Q539L probably benign Het
Vmn2r17 T A 5: 109,600,831 (GRCm39) C710S possibly damaging Het
Vmn2r99 G T 17: 19,614,079 (GRCm39) V600F possibly damaging Het
Vps13d C T 4: 144,826,635 (GRCm39) V2879M Het
Vrtn T A 12: 84,697,080 (GRCm39) M610K probably benign Het
Xpo4 T C 14: 57,850,806 (GRCm39) E366G probably benign Het
Zyg11a G A 4: 108,040,845 (GRCm39) P703S probably damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1501:Smchd1 UTSW 17 71,672,089 (GRCm39) missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TACACCGTCCTACAGCCGTC -3'
(R):5'- TAGCTAGTGTCCACCGCACC -3'

Sequencing Primer
(F):5'- TCTCCCAGATCCCTCCGAGAG -3'
(R):5'- ACACGCTTGCGAGTTGC -3'
Posted On 2020-06-01