Incidental Mutation 'R3277:Sema4c'
ID 258243
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms M-Sema F, Semacl1, Semaf, Semai, Semacl1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 36587720-36597430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36588960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 722 (R722H)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000195620] [ENSMUST00000207843] [ENSMUST00000194894] [ENSMUST00000193382]
AlphaFold Q64151
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114990
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110641
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114991
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191642
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191677
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect possibly damaging
Transcript: ENSMUST00000195620
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208690
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably benign
Transcript: ENSMUST00000194894
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,020 (GRCm39) R553G possibly damaging Het
Adarb2 A G 13: 8,802,663 (GRCm39) N646S probably damaging Het
Adcy8 C T 15: 64,571,008 (GRCm39) G1242S probably benign Het
Ano9 T A 7: 140,684,037 (GRCm39) T543S probably damaging Het
Btnl10 A G 11: 58,813,216 (GRCm39) K282E probably benign Het
Btnl9 T C 11: 49,060,503 (GRCm39) D330G probably damaging Het
Ccdc178 G T 18: 22,200,709 (GRCm39) A416E possibly damaging Het
Cdx2 A T 5: 147,240,002 (GRCm39) S225T probably benign Het
Clca4b T C 3: 144,617,120 (GRCm39) I843M probably benign Het
Cntn4 G A 6: 106,414,925 (GRCm39) probably null Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Dennd4a G T 9: 64,796,275 (GRCm39) R767L probably damaging Het
Dgkb G A 12: 38,134,216 (GRCm39) V41M probably damaging Het
Duox1 T C 2: 122,170,597 (GRCm39) Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 (GRCm39) probably null Het
Fbxw2 T C 2: 34,712,762 (GRCm39) T100A probably benign Het
Fcgbp C A 7: 27,791,086 (GRCm39) H782Q probably damaging Het
Flg2 A T 3: 93,122,195 (GRCm39) Q1455L unknown Het
Frrs1 T C 3: 116,692,873 (GRCm39) F49S probably damaging Het
Gli3 A T 13: 15,900,567 (GRCm39) Q1318L probably benign Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gm7104 A T 12: 88,252,498 (GRCm39) noncoding transcript Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hacd4 T C 4: 88,355,747 (GRCm39) H46R probably damaging Het
Herc2 T C 7: 55,803,176 (GRCm39) V2175A probably benign Het
Hey1 T C 3: 8,729,951 (GRCm39) S169G probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hlf T C 11: 90,236,661 (GRCm39) K199E probably damaging Het
Hpgd C A 8: 56,751,448 (GRCm39) A92E probably damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Itgad C A 7: 127,790,153 (GRCm39) H651N possibly damaging Het
Itgav A G 2: 83,606,886 (GRCm39) D409G probably damaging Het
Kif2a A G 13: 107,113,264 (GRCm39) I455T probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lamc3 G T 2: 31,798,637 (GRCm39) G448C probably damaging Het
Ltbp1 G A 17: 75,583,475 (GRCm39) G425D possibly damaging Het
Ltbp1 T A 17: 75,666,273 (GRCm39) probably null Het
Mag C T 7: 30,601,073 (GRCm39) probably null Het
Mdh1b G A 1: 63,750,690 (GRCm39) T426M possibly damaging Het
Nr1h4 G A 10: 89,314,650 (GRCm39) T282I possibly damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Or4c1 C T 2: 89,133,562 (GRCm39) V125M possibly damaging Het
Or52k2 T C 7: 102,253,783 (GRCm39) V74A possibly damaging Het
Or9s27 A G 1: 92,516,535 (GRCm39) N161S probably benign Het
Padi6 A G 4: 140,462,700 (GRCm39) L307P probably damaging Het
Parp9 T C 16: 35,768,578 (GRCm39) S20P probably damaging Het
Pdcd11 T C 19: 47,101,703 (GRCm39) F963L probably damaging Het
Pwp1 C T 10: 85,717,943 (GRCm39) L294F probably benign Het
Radil A G 5: 142,492,611 (GRCm39) L339P probably damaging Het
Raver1 G A 9: 20,990,573 (GRCm39) P316S possibly damaging Het
Rell1 A G 5: 64,084,330 (GRCm39) probably null Het
Rxrg A G 1: 167,463,269 (GRCm39) D257G possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Spata7 A G 12: 98,603,857 (GRCm39) N75D possibly damaging Het
Ttc23l A G 15: 10,547,318 (GRCm39) F99L possibly damaging Het
Unc13a A C 8: 72,082,339 (GRCm39) C1642G probably benign Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Wrn A G 8: 33,807,582 (GRCm39) M292T probably damaging Het
Zfp423 A G 8: 88,508,959 (GRCm39) Y462H probably damaging Het
Zscan5b T A 7: 6,234,345 (GRCm39) Y124N possibly damaging Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36,593,001 (GRCm39) critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36,592,110 (GRCm39) missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36,592,166 (GRCm39) missense probably damaging 1.00
IGL02262:Sema4c APN 1 36,589,422 (GRCm39) missense probably damaging 1.00
IGL02282:Sema4c APN 1 36,589,284 (GRCm39) splice site probably null
IGL02476:Sema4c APN 1 36,595,031 (GRCm39) missense probably damaging 0.98
IGL02900:Sema4c APN 1 36,589,826 (GRCm39) nonsense probably null
swirl UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36,591,965 (GRCm39) missense probably damaging 1.00
R0427:Sema4c UTSW 1 36,592,892 (GRCm39) nonsense probably null
R0497:Sema4c UTSW 1 36,588,689 (GRCm39) missense probably benign 0.04
R1066:Sema4c UTSW 1 36,589,281 (GRCm39) missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36,591,191 (GRCm39) missense probably damaging 1.00
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1639:Sema4c UTSW 1 36,592,615 (GRCm39) missense probably benign 0.00
R1644:Sema4c UTSW 1 36,589,885 (GRCm39) missense probably damaging 1.00
R3176:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36,592,804 (GRCm39) missense probably benign 0.02
R4452:Sema4c UTSW 1 36,592,837 (GRCm39) missense probably benign 0.31
R4883:Sema4c UTSW 1 36,591,097 (GRCm39) missense probably damaging 0.98
R4895:Sema4c UTSW 1 36,592,651 (GRCm39) splice site probably null
R4913:Sema4c UTSW 1 36,589,266 (GRCm39) missense probably benign 0.11
R4944:Sema4c UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
R5062:Sema4c UTSW 1 36,592,059 (GRCm39) critical splice donor site probably null
R5077:Sema4c UTSW 1 36,590,812 (GRCm39) missense probably benign 0.20
R5109:Sema4c UTSW 1 36,591,381 (GRCm39) frame shift probably null
R5208:Sema4c UTSW 1 36,589,407 (GRCm39) missense probably damaging 1.00
R5551:Sema4c UTSW 1 36,591,398 (GRCm39) missense probably damaging 1.00
R5912:Sema4c UTSW 1 36,593,469 (GRCm39) missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36,589,834 (GRCm39) missense probably benign 0.02
R7111:Sema4c UTSW 1 36,592,160 (GRCm39) missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36,592,101 (GRCm39) missense probably damaging 0.99
R7252:Sema4c UTSW 1 36,589,096 (GRCm39) missense probably damaging 1.00
R7495:Sema4c UTSW 1 36,589,774 (GRCm39) missense probably benign 0.00
R7891:Sema4c UTSW 1 36,588,995 (GRCm39) missense probably damaging 0.98
R7895:Sema4c UTSW 1 36,592,199 (GRCm39) missense probably damaging 1.00
R8264:Sema4c UTSW 1 36,591,966 (GRCm39) missense probably damaging 1.00
R8478:Sema4c UTSW 1 36,590,871 (GRCm39) missense probably benign 0.04
R8680:Sema4c UTSW 1 36,589,867 (GRCm39) missense probably benign 0.00
R8733:Sema4c UTSW 1 36,591,954 (GRCm39) missense probably damaging 1.00
R9017:Sema4c UTSW 1 36,592,079 (GRCm39) missense probably damaging 1.00
R9344:Sema4c UTSW 1 36,592,395 (GRCm39) missense probably damaging 1.00
R9488:Sema4c UTSW 1 36,591,067 (GRCm39) missense probably benign
X0019:Sema4c UTSW 1 36,592,077 (GRCm39) missense probably damaging 1.00
X0028:Sema4c UTSW 1 36,589,047 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGAGTTCCGACCACCTCCTAG -3'
(R):5'- AAGCTACCTTGTTGCTGTCG -3'

Sequencing Primer
(F):5'- CCTAGGTGGAGCCGAGTTG -3'
(R):5'- TTGGAAAACCTGGGGCTC -3'
Posted On 2015-01-23