Incidental Mutation 'R3705:Tph2'
ID258715
Institutional Source Beutler Lab
Gene Symbol Tph2
Ensembl Gene ENSMUSG00000006764
Gene Nametryptophan hydroxylase 2
Synonyms
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R3705 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115078641-115185022 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 115119893 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 332 (Q332*)
Ref Sequence ENSEMBL: ENSMUSP00000006949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006949]
Predicted Effect probably null
Transcript: ENSMUST00000006949
AA Change: Q332*
SMART Domains Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: Q332*

DomainStartEndE-ValueType
low complexity region 94 102 N/A INTRINSIC
Pfam:Biopterin_H 150 480 3.6e-177 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Tph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Tph2 APN 10 115079759 nonsense probably null
IGL01989:Tph2 APN 10 115146016 missense probably benign 0.22
IGL02363:Tph2 APN 10 115079981 missense probably benign 0.01
IGL02667:Tph2 APN 10 115080045 missense probably benign 0.43
R0390:Tph2 UTSW 10 115174109 missense probably damaging 1.00
R0400:Tph2 UTSW 10 115080120 splice site probably benign
R0570:Tph2 UTSW 10 115174134 splice site probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1654:Tph2 UTSW 10 115184807 missense probably benign
R3710:Tph2 UTSW 10 115174058 missense probably benign 0.42
R3777:Tph2 UTSW 10 115080005 missense probably benign
R4794:Tph2 UTSW 10 115182770 missense possibly damaging 0.84
R5015:Tph2 UTSW 10 115079716 missense probably benign 0.01
R5068:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5069:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5070:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5422:Tph2 UTSW 10 115079764 missense possibly damaging 0.94
R5487:Tph2 UTSW 10 115119874 missense probably damaging 1.00
R5604:Tph2 UTSW 10 115090709 missense probably damaging 1.00
R5692:Tph2 UTSW 10 115184827 missense probably damaging 0.97
R6368:Tph2 UTSW 10 115179326 missense probably damaging 1.00
R6802:Tph2 UTSW 10 115184873 missense probably damaging 1.00
R6823:Tph2 UTSW 10 115174106 missense probably benign 0.02
R7371:Tph2 UTSW 10 115151111 missense probably damaging 1.00
R7724:Tph2 UTSW 10 115079822 missense probably benign
R7863:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R7946:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R8046:Tph2 UTSW 10 115179594 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGCTCTCCCCAGAACATAGG -3'
(R):5'- GGTGCATTTACATTTCAGGCATG -3'

Sequencing Primer
(F):5'- CATAGGCCTAAGAGTCATGGTC -3'
(R):5'- CATTTCAGGCATGACTAATGGTAATC -3'
Posted On2015-01-23