Incidental Mutation 'R3023:Vmn2r78'
ID265754
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Namevomeronasal 2, receptor 78
Synonyms
MMRRC Submission 040539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3023 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86915300-86955177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86954966 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 784 (S784I)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
Predicted Effect probably damaging
Transcript: ENSMUST00000170835
AA Change: S784I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: S784I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,669,572 E1060D probably benign Het
Abca15 A T 7: 120,382,779 I1106F probably benign Het
Arl5a A G 2: 52,416,197 V41A probably benign Het
Atp8b5 A G 4: 43,311,957 D190G possibly damaging Het
Cc2d2a T A 5: 43,685,251 probably null Het
Ckap2 T C 8: 22,175,861 N390S possibly damaging Het
Dtx3l A G 16: 35,932,436 I600T probably benign Het
Epb41l1 A C 2: 156,514,209 E555A probably damaging Het
Fxr1 G A 3: 34,064,224 R503H probably damaging Het
Igf1r A G 7: 68,183,399 N436D probably benign Het
Kif26b G A 1: 178,864,868 C11Y probably damaging Het
Olfr1251 A G 2: 89,667,646 I80T possibly damaging Het
Osbpl6 A T 2: 76,586,733 I703F probably damaging Het
Plcd4 A G 1: 74,548,192 Y37C probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pwwp2b G A 7: 139,256,194 R517H probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Sdk1 C G 5: 142,046,236 T1022S probably benign Het
Slc12a7 T A 13: 73,800,422 S669T probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Tlr2 C T 3: 83,837,871 V302I probably benign Het
Trav7-6 A G 14: 53,717,244 K77R probably benign Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCATTTGTTGATGCTGATCTACAC -3'
(R):5'- AGTAAGCAGTATGGTGATCATGC -3'

Sequencing Primer
(F):5'- GCTGATCTACACATGATACATGAAC -3'
(R):5'- TCATGCTGATATGTTTGGTGTAATAG -3'
Posted On2015-02-05