Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Atf7ip'

169442

Institutional Source

Beutler Lab

Gene Symbol

Atf7ip

Ensembl Gene

ENSMUSG00000030213

Gene Name

activating transcription factor 7 interacting protein

Synonyms

Mcaf1, 2610204M12Rik, AM, ATFa-associated Modulator

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.884) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136506167-136610862 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 136606867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1299 (V1299L)

Ref Sequence

ENSEMBL: ENSMUSP00000032335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032335]

AlphaFold

Q7TT18

Predicted Effect

probably damaging
Transcript: ENSMUST00000032335
AA Change: V1299L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: V1299L

Domain	Start	End	E-Value	Type
internal_repeat_1	123	144	9.59e-5	PROSPERO
internal_repeat_1	143	164	9.59e-5	PROSPERO
low complexity region	184	212	N/A	INTRINSIC
low complexity region	246	262	N/A	INTRINSIC
low complexity region	284	303	N/A	INTRINSIC
low complexity region	409	427	N/A	INTRINSIC
low complexity region	567	582	N/A	INTRINSIC
Pfam:ATF7IP_BD	598	813	5.5e-62	PFAM
low complexity region	864	889	N/A	INTRINSIC
PDB:2RPQ\|B	974	1017	5e-7	PDB
low complexity region	1022	1036	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1168	1192	N/A	INTRINSIC
FN3	1194	1288	3.4e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185332

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Atf7ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Atf7ip	APN	6	136560681	missense	probably benign	0.00
IGL01483:Atf7ip	APN	6	136587459	missense	probably damaging	1.00
IGL02313:Atf7ip	APN	6	136606720	missense	probably damaging	0.99
IGL02319:Atf7ip	APN	6	136593118	missense	probably benign	0.01
IGL02547:Atf7ip	APN	6	136603276	splice site	probably benign
IGL02869:Atf7ip	APN	6	136606579	missense	probably damaging	0.99
IGL02895:Atf7ip	APN	6	136560688	missense	probably damaging	0.99
IGL02967:Atf7ip	APN	6	136606727	missense	probably damaging	0.98
IGL03026:Atf7ip	APN	6	136605382	missense	possibly damaging	0.79
fuegado	UTSW	6	136560710	missense	probably benign
Outtahere	UTSW	6	136565106	missense	probably damaging	1.00
Severance	UTSW	6	136559816	missense	probably damaging	1.00
R0024:Atf7ip	UTSW	6	136599820	splice site	probably benign
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0045:Atf7ip	UTSW	6	136559816	missense	probably damaging	1.00
R0325:Atf7ip	UTSW	6	136560989	missense	possibly damaging	0.86
R0331:Atf7ip	UTSW	6	136561163	missense	possibly damaging	0.94
R0415:Atf7ip	UTSW	6	136560012	missense	possibly damaging	0.92
R0490:Atf7ip	UTSW	6	136609192	unclassified	probably benign
R0526:Atf7ip	UTSW	6	136559805	missense	probably damaging	1.00
R1663:Atf7ip	UTSW	6	136603324	missense	possibly damaging	0.93
R1793:Atf7ip	UTSW	6	136609219	unclassified	probably benign
R1822:Atf7ip	UTSW	6	136587260	missense	probably benign	0.11
R1873:Atf7ip	UTSW	6	136559888	missense	probably damaging	1.00
R1937:Atf7ip	UTSW	6	136560780	missense	probably benign	0.41
R2059:Atf7ip	UTSW	6	136609348	unclassified	probably benign
R2134:Atf7ip	UTSW	6	136605487	missense	possibly damaging	0.80
R2679:Atf7ip	UTSW	6	136566651	missense	possibly damaging	0.62
R3430:Atf7ip	UTSW	6	136575324	unclassified	probably benign
R3755:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3756:Atf7ip	UTSW	6	136560817	missense	probably benign	0.01
R3890:Atf7ip	UTSW	6	136587045	missense	possibly damaging	0.48
R4190:Atf7ip	UTSW	6	136587501	missense	probably damaging	1.00
R4494:Atf7ip	UTSW	6	136563749	splice site	probably null
R4588:Atf7ip	UTSW	6	136599694	missense	probably benign
R4618:Atf7ip	UTSW	6	136565106	missense	probably damaging	1.00
R4705:Atf7ip	UTSW	6	136561194	missense	probably damaging	1.00
R4838:Atf7ip	UTSW	6	136596491	missense	probably benign	0.06
R4922:Atf7ip	UTSW	6	136560041	missense	possibly damaging	0.91
R4956:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R4957:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R4958:Atf7ip	UTSW	6	136606810	missense	probably damaging	1.00
R5000:Atf7ip	UTSW	6	136582428	missense	probably damaging	1.00
R5001:Atf7ip	UTSW	6	136561388	missense	probably damaging	0.99
R5075:Atf7ip	UTSW	6	136560234	missense	probably benign
R5279:Atf7ip	UTSW	6	136603379	nonsense	probably null
R5445:Atf7ip	UTSW	6	136587257	missense	probably damaging	1.00
R5844:Atf7ip	UTSW	6	136606814	missense	probably damaging	1.00
R5850:Atf7ip	UTSW	6	136566787	critical splice donor site	probably null
R5891:Atf7ip	UTSW	6	136559977	missense	possibly damaging	0.64
R5987:Atf7ip	UTSW	6	136571502	missense	probably damaging	1.00
R6168:Atf7ip	UTSW	6	136559819	missense	probably damaging	1.00
R6726:Atf7ip	UTSW	6	136582391	missense	probably damaging	1.00
R6880:Atf7ip	UTSW	6	136561040	missense	probably damaging	1.00
R6924:Atf7ip	UTSW	6	136559757	splice site	probably null
R7075:Atf7ip	UTSW	6	136596515	critical splice donor site	probably null
R7308:Atf7ip	UTSW	6	136565089	missense	probably benign	0.01
R7365:Atf7ip	UTSW	6	136560710	missense	probably benign
R7556:Atf7ip	UTSW	6	136561241	missense	probably damaging	0.99
R7812:Atf7ip	UTSW	6	136603417	missense	probably damaging	0.96
R7973:Atf7ip	UTSW	6	136561064	nonsense	probably null
R8032:Atf7ip	UTSW	6	136565112	missense	probably benign	0.00
R8203:Atf7ip	UTSW	6	136606783	missense	probably damaging	0.99
R8274:Atf7ip	UTSW	6	136560990	missense	probably benign
R8784:Atf7ip	UTSW	6	136599650	missense	probably damaging	0.99
R8785:Atf7ip	UTSW	6	136587164	missense	probably damaging	0.97
R8885:Atf7ip	UTSW	6	136587143	missense	probably benign	0.06
R8957:Atf7ip	UTSW	6	136566703	missense	probably null	0.99
R9042:Atf7ip	UTSW	6	136561265	nonsense	probably null
R9531:Atf7ip	UTSW	6	136560877	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCTATGCTTACCACGAGGAGCC -3'
(R):5'- CAGGAGATCGCACTGTGATACACAC -3'

Sequencing Primer
(F):5'- CCACGAGGAGCCCAGTG -3'
(R):5'- AATTGTTCAGGGAAGGCTTGC -3'

Posted On

2014-04-13