Incidental Mutation 'R4301:Lrrc30'
Institutional Source Beutler Lab
Gene Symbol Lrrc30
Ensembl Gene ENSMUSG00000073375
Gene Nameleucine rich repeat containing 30
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location67630965-67632723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67632568 bp
Amino Acid Change Serine to Proline at position 6 (S6P)
Ref Sequence ENSEMBL: ENSMUSP00000094893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097290]
Predicted Effect probably damaging
Transcript: ENSMUST00000097290
AA Change: S6P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094893
Gene: ENSMUSG00000073375
AA Change: S6P

LRR_TYP 69 92 1.67e-2 SMART
LRR 115 138 1.73e0 SMART
LRR 139 160 1.91e1 SMART
LRR_TYP 161 184 2.53e-2 SMART
Blast:LRR 207 229 1e-5 BLAST
LRR 230 253 3.29e-1 SMART
Meta Mutation Damage Score 0.2267 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Lrrc30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Lrrc30 APN 17 67632039 missense probably damaging 1.00
IGL00957:Lrrc30 APN 17 67632504 missense probably benign 0.00
IGL02500:Lrrc30 APN 17 67631862 missense probably damaging 1.00
R1666:Lrrc30 UTSW 17 67632205 missense probably benign 0.39
R1769:Lrrc30 UTSW 17 67631681 makesense probably null
R2079:Lrrc30 UTSW 17 67631880 missense possibly damaging 0.80
R3405:Lrrc30 UTSW 17 67632180 missense probably damaging 1.00
R3406:Lrrc30 UTSW 17 67632180 missense probably damaging 1.00
R6399:Lrrc30 UTSW 17 67632686 start gained probably benign
R6469:Lrrc30 UTSW 17 67631865 missense probably benign
R7079:Lrrc30 UTSW 17 67632021 missense possibly damaging 0.96
R7454:Lrrc30 UTSW 17 67632243 missense probably damaging 0.97
R7611:Lrrc30 UTSW 17 67632429 missense probably damaging 0.97
R7642:Lrrc30 UTSW 17 67632477 missense probably damaging 1.00
X0027:Lrrc30 UTSW 17 67632459 missense probably damaging 1.00
Z1088:Lrrc30 UTSW 17 67631695 missense possibly damaging 0.93
Z1176:Lrrc30 UTSW 17 67632436 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20