Incidental Mutation 'R4301:Fer'
ID322434
Institutional Source Beutler Lab
Gene Symbol Fer
Ensembl Gene ENSMUSG00000000127
Gene Namefer (fms/fps related) protein kinase
SynonymsFert, Fert2
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location63896018-64139494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64078910 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 292 (L292F)
Ref Sequence ENSEMBL: ENSMUSP00000037418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000129] [ENSMUST00000038080]
Predicted Effect probably damaging
Transcript: ENSMUST00000000129
AA Change: L662F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000129
Gene: ENSMUSG00000000127
AA Change: L662F

DomainStartEndE-ValueType
FCH 1 92 1.29e-27 SMART
coiled coil region 123 174 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
coiled coil region 308 381 N/A INTRINSIC
SH2 459 538 5.9e-30 SMART
TyrKc 564 815 6.69e-148 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000038080
AA Change: L292F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037418
Gene: ENSMUSG00000000127
AA Change: L292F

DomainStartEndE-ValueType
SH2 89 168 5.9e-30 SMART
TyrKc 194 445 6.69e-148 SMART
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FPS/FES family of non-transmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit elevated lipopolysaccharide-induced leukocyte adhesion and migration. Mutant cells also exhibit reduced phosphorylation of cortactin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Fer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Fer APN 17 64037626 missense probably damaging 1.00
IGL02004:Fer APN 17 63924179 critical splice donor site probably null
IGL02103:Fer APN 17 64138928 missense probably benign 0.02
IGL02157:Fer APN 17 64138899 missense probably benign 0.03
IGL02217:Fer APN 17 64138965 missense probably benign 0.00
IGL02376:Fer APN 17 63934346 missense possibly damaging 0.69
IGL02955:Fer APN 17 63991717 critical splice donor site probably null
IGL02967:Fer APN 17 63896267 missense possibly damaging 0.69
IGL03392:Fer APN 17 63991642 missense probably damaging 0.97
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0207:Fer UTSW 17 63896278 missense probably damaging 1.00
R0243:Fer UTSW 17 64078946 missense probably benign 0.00
R0309:Fer UTSW 17 64139016 makesense probably null
R0384:Fer UTSW 17 63924184 splice site probably benign
R0634:Fer UTSW 17 64035508 missense probably benign 0.40
R1885:Fer UTSW 17 64138914 missense probably damaging 0.96
R1939:Fer UTSW 17 63973128 missense probably damaging 1.00
R2427:Fer UTSW 17 63957303 missense probably benign
R2504:Fer UTSW 17 63991580 splice site probably null
R4404:Fer UTSW 17 63941289 critical splice acceptor site probably null
R4418:Fer UTSW 17 64029291 missense possibly damaging 0.89
R4812:Fer UTSW 17 63934297 missense probably benign
R5561:Fer UTSW 17 64037585 nonsense probably null
R5724:Fer UTSW 17 63924157 missense probably damaging 1.00
R5936:Fer UTSW 17 63924063 missense probably benign
R6157:Fer UTSW 17 64078885 missense probably damaging 1.00
R6848:Fer UTSW 17 63991606 missense probably damaging 1.00
R7175:Fer UTSW 17 63924095 missense probably benign 0.01
R7198:Fer UTSW 17 63921688 missense possibly damaging 0.84
R7438:Fer UTSW 17 64133521 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTGGACAAAGCACTGTGGAAC -3'
(R):5'- GTTTCTGTAGAGCTAGAAACAATGC -3'

Sequencing Primer
(F):5'- GCACTGTGGAACCTAAAGTGCTTC -3'
(R):5'- GTAGAGCTAGAAACAATGCTTTCAC -3'
Posted On2015-06-20