Mutagenetix > Incidental Mutations

Incidental Mutation 'R4301:Fer'

322434

Institutional Source

Beutler Lab

Gene Symbol

Fer

Ensembl Gene

ENSMUSG00000000127

Gene Name

fer (fms/fps related) protein kinase

Synonyms

Fert, Fert2

MMRRC Submission

041088-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63896018-64139494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 64078910 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 292 (L292F)

Ref Sequence

ENSEMBL: ENSMUSP00000037418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000129] [ENSMUST00000038080]

Predicted Effect

probably damaging
Transcript: ENSMUST00000000129
AA Change: L662F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000129
Gene: ENSMUSG00000000127
AA Change: L662F

Domain	Start	End	E-Value	Type
FCH	1	92	1.29e-27	SMART
coiled coil region	123	174	N/A	INTRINSIC
low complexity region	283	294	N/A	INTRINSIC
coiled coil region	308	381	N/A	INTRINSIC
SH2	459	538	5.9e-30	SMART
TyrKc	564	815	6.69e-148	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000038080
AA Change: L292F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037418
Gene: ENSMUSG00000000127
AA Change: L292F

Domain	Start	End	E-Value	Type
SH2	89	168	5.9e-30	SMART
TyrKc	194	445	6.69e-148	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FPS/FES family of non-transmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit elevated lipopolysaccharide-induced leukocyte adhesion and migration. Mutant cells also exhibit reduced phosphorylation of cortactin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	A	16: 56,556,903	V95D	probably damaging	Het
Adamtsl2	A	G	2: 27,087,283	D252G	probably null	Het
Adgra3	T	C	5: 49,961,078	R1043G	possibly damaging	Het
Atxn7l1	A	G	12: 33,367,238	D562G	probably damaging	Het
Ccdc70	T	C	8: 21,973,212	V6A	possibly damaging	Het
Cdc25a	T	C	9: 109,889,742	V337A	probably benign	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Crb1	A	G	1: 139,248,830	S472P	probably benign	Het
Fam193b	G	A	13: 55,542,604	R740*	probably null	Het
Gmppa	G	A	1: 75,442,496	R349H	possibly damaging	Het
Hspa1a	T	C	17: 34,970,506	I474V	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Lrrc30	A	G	17: 67,632,568	S6P	probably damaging	Het
Lzts3	A	G	2: 130,636,438	S133P	probably damaging	Het
Mkl2	T	C	16: 13,398,305	Y294H	probably damaging	Het
Mtmr12	T	A	15: 12,236,020	F122I	possibly damaging	Het
Mypn	A	G	10: 63,118,484	Y124H	probably damaging	Het
Nfat5	T	C	8: 107,355,695		probably benign	Het
Npr2	T	C	4: 43,641,332		probably null	Het
Olfr1441	T	C	19: 12,422,717	L136P	probably damaging	Het
Pgm1	G	A	5: 64,103,797	W51*	probably null	Het
Phip	G	A	9: 82,959,713	R48*	probably null	Het
Piezo2	T	C	18: 63,084,840	T1075A	probably damaging	Het
Ppat	G	T	5: 76,928,501		probably benign	Het
Ppp2r2b	T	A	18: 42,898,746	E23D	probably null	Het
Prickle1	T	C	15: 93,508,636	I169V	possibly damaging	Het
Rab37	T	A	11: 115,158,564	D95E	possibly damaging	Het
Sash1	A	G	10: 8,751,470	V50A	probably benign	Het
Siae	C	A	9: 37,633,713	Q335K	possibly damaging	Het
Snx14	A	T	9: 88,410,623	I217K	probably damaging	Het
Son	A	G	16: 91,658,411	T1349A	possibly damaging	Het
Sptb	A	G	12: 76,612,697	L1143S	probably damaging	Het
Trim80	T	C	11: 115,445,113		probably null	Het
Trpm3	T	C	19: 22,987,292	S1374P	probably benign	Het
Vldlr	C	A	19: 27,238,402	D266E	possibly damaging	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zbtb10	A	T	3: 9,265,160	Q526L	probably damaging	Het
Zfr2	T	C	10: 81,242,184		probably benign	Het
Zswim8	G	A	14: 20,713,909	R449H	possibly damaging	Het
Zzef1	T	C	11: 72,889,035	V1878A	probably damaging	Het

Other mutations in Fer

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01625:Fer	APN	17	64037626	missense	probably damaging	1.00
IGL02004:Fer	APN	17	63924179	critical splice donor site	probably null
IGL02103:Fer	APN	17	64138928	missense	probably benign	0.02
IGL02157:Fer	APN	17	64138899	missense	probably benign	0.03
IGL02217:Fer	APN	17	64138965	missense	probably benign	0.00
IGL02376:Fer	APN	17	63934346	missense	possibly damaging	0.69
IGL02955:Fer	APN	17	63991717	critical splice donor site	probably null
IGL02967:Fer	APN	17	63896267	missense	possibly damaging	0.69
IGL03392:Fer	APN	17	63991642	missense	probably damaging	0.97
R0095:Fer	UTSW	17	63941326	missense	possibly damaging	0.51
R0095:Fer	UTSW	17	63941326	missense	possibly damaging	0.51
R0207:Fer	UTSW	17	63896278	missense	probably damaging	1.00
R0243:Fer	UTSW	17	64078946	missense	probably benign	0.00
R0309:Fer	UTSW	17	64139016	makesense	probably null
R0384:Fer	UTSW	17	63924184	splice site	probably benign
R0634:Fer	UTSW	17	64035508	missense	probably benign	0.40
R1885:Fer	UTSW	17	64138914	missense	probably damaging	0.96
R1939:Fer	UTSW	17	63973128	missense	probably damaging	1.00
R2427:Fer	UTSW	17	63957303	missense	probably benign
R2504:Fer	UTSW	17	63991580	splice site	probably null
R4404:Fer	UTSW	17	63941289	critical splice acceptor site	probably null
R4418:Fer	UTSW	17	64029291	missense	possibly damaging	0.89
R4812:Fer	UTSW	17	63934297	missense	probably benign
R5561:Fer	UTSW	17	64037585	nonsense	probably null
R5724:Fer	UTSW	17	63924157	missense	probably damaging	1.00
R5936:Fer	UTSW	17	63924063	missense	probably benign
R6157:Fer	UTSW	17	64078885	missense	probably damaging	1.00
R6848:Fer	UTSW	17	63991606	missense	probably damaging	1.00
R7175:Fer	UTSW	17	63924095	missense	probably benign	0.01
R7198:Fer	UTSW	17	63921688	missense	possibly damaging	0.84
R7438:Fer	UTSW	17	64133521	missense	possibly damaging	0.91
R7723:Fer	UTSW	17	63896278	missense	probably damaging	1.00
R7949:Fer	UTSW	17	64133508	missense	probably damaging	1.00
R8064:Fer	UTSW	17	63907423	missense	probably benign	0.04
R8472:Fer	UTSW	17	63973149	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGGACAAAGCACTGTGGAAC -3'
(R):5'- GTTTCTGTAGAGCTAGAAACAATGC -3'

Sequencing Primer
(F):5'- GCACTGTGGAACCTAAAGTGCTTC -3'
(R):5'- GTAGAGCTAGAAACAATGCTTTCAC -3'

Posted On

2015-06-20