Incidental Mutation 'R4301:Rab37'
ID322422
Institutional Source Beutler Lab
Gene Symbol Rab37
Ensembl Gene ENSMUSG00000020732
Gene NameRAB37, member RAS oncogene family
SynonymsB230331O03Rik, B230354I04Rik
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115091431-115162236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115158564 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 95 (D95E)
Ref Sequence ENSEMBL: ENSMUSP00000065016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021076] [ENSMUST00000021077] [ENSMUST00000067754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021076
AA Change: D102E

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021076
Gene: ENSMUSG00000020732
AA Change: D102E

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 31 194 9.38e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021077
SMART Domains Protein: ENSMUSP00000021077
Gene: ENSMUSG00000020733

DomainStartEndE-ValueType
PDZ 22 94 2.9e-20 SMART
PDZ 157 229 6.03e-18 SMART
Pfam:EBP50_C 230 355 1.4e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000067754
AA Change: D95E

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065016
Gene: ENSMUSG00000020732
AA Change: D95E

DomainStartEndE-ValueType
RAB 23 187 1.27e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156383
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rab proteins are low molecular mass GTPases that are critical regulators of vesicle trafficking. For additional background information on Rab proteins, see MIM 179508.[supplied by OMIM, Apr 2006]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Rab37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Rab37 APN 11 115160717 missense probably benign 0.00
IGL03278:Rab37 APN 11 115159691 missense possibly damaging 0.59
R0051:Rab37 UTSW 11 115158665 missense probably damaging 1.00
R0360:Rab37 UTSW 11 115156964 missense probably damaging 1.00
R0364:Rab37 UTSW 11 115156964 missense probably damaging 1.00
R0592:Rab37 UTSW 11 115160523 splice site probably benign
R0639:Rab37 UTSW 11 115158702 missense probably benign 0.04
R1958:Rab37 UTSW 11 115160351 missense probably damaging 1.00
R5423:Rab37 UTSW 11 115157027 missense possibly damaging 0.63
R6196:Rab37 UTSW 11 115160306 missense probably benign 0.30
R6488:Rab37 UTSW 11 115157963 missense probably benign 0.01
R7539:Rab37 UTSW 11 115160661 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTTGAGAACTGTGAGAAACC -3'
(R):5'- TTCTGGCTGCTCATGACAGG -3'

Sequencing Primer
(F):5'- CCTTGAGAACTGTGAGAAACCCAAAG -3'
(R):5'- CTCATGACAGGCAGGGTTG -3'
Posted On2015-06-20