Incidental Mutation 'R4301:Ppat'
ID322409
Institutional Source Beutler Lab
Gene Symbol Ppat
Ensembl Gene ENSMUSG00000029246
Gene Namephosphoribosyl pyrophosphate amidotransferase
Synonyms
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76913249-76951578 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 76928501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140076] [ENSMUST00000155272]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101090
Predicted Effect probably benign
Transcript: ENSMUST00000140076
SMART Domains Protein: ENSMUSP00000120632
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
Pfam:GATase_4 27 218 4e-11 PFAM
Pfam:GATase_6 74 216 1.6e-18 PFAM
Pfam:GATase_7 91 241 1.6e-16 PFAM
Pfam:Pribosyltran 309 420 1.3e-9 PFAM
low complexity region 474 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145897
Predicted Effect probably benign
Transcript: ENSMUST00000155272
SMART Domains Protein: ENSMUSP00000116438
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
SCOP:d1ecfa2 12 43 6e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Ppat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Ppat APN 5 76915232 missense probably damaging 1.00
IGL02679:Ppat APN 5 76919469 missense probably benign 0.10
R0836:Ppat UTSW 5 76922501 missense probably benign 0.09
R2327:Ppat UTSW 5 76922467 missense possibly damaging 0.94
R2850:Ppat UTSW 5 76919375 missense probably benign
R3434:Ppat UTSW 5 76918065 missense probably damaging 0.99
R4422:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4423:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4424:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4839:Ppat UTSW 5 76950964 nonsense probably null
R4872:Ppat UTSW 5 76926793 missense probably damaging 0.99
R5007:Ppat UTSW 5 76928678 intron probably benign
R5010:Ppat UTSW 5 76928678 intron probably benign
R5325:Ppat UTSW 5 76928422 intron probably benign
R5982:Ppat UTSW 5 76915265 missense probably benign
R6209:Ppat UTSW 5 76918146 missense probably benign 0.00
R6225:Ppat UTSW 5 76922355 missense probably damaging 0.99
R6287:Ppat UTSW 5 76918214 nonsense probably null
R7367:Ppat UTSW 5 76919864 nonsense probably null
R7426:Ppat UTSW 5 76915979 missense probably damaging 0.99
R8047:Ppat UTSW 5 76925710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTCTCAAGCTCTTCAGAG -3'
(R):5'- CGGTTCAGACTGCAGGATTG -3'

Sequencing Primer
(F):5'- TCTTCAGAGCTCATGGACAAC -3'
(R):5'- ATTGCGTCCAGAGCGTG -3'
Posted On2015-06-20