Incidental Mutation 'R4301:Siae'
ID 322413
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Name sialic acid acetylesterase
Synonyms LSE, clone 165, Ysg2
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4301 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 37555698-37649655 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37633713 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 335 (Q335K)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000213126] [ENSMUST00000215474]
AlphaFold P70665
Predicted Effect possibly damaging
Transcript: ENSMUST00000002007
AA Change: Q263K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942
AA Change: Q263K

signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213126
AA Change: Q300K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215474
AA Change: Q335K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217567
Meta Mutation Damage Score 0.1347 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trim80 T C 11: 115,445,113 probably null Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
BB009:Siae UTSW 9 37633684 missense probably benign 0.12
BB019:Siae UTSW 9 37633684 missense probably benign 0.12
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
R7697:Siae UTSW 9 37633654 missense probably damaging 1.00
R7821:Siae UTSW 9 37644900 missense probably damaging 1.00
R7932:Siae UTSW 9 37633684 missense probably benign 0.12
R8312:Siae UTSW 9 37646297 missense
R8377:Siae UTSW 9 37631605 critical splice donor site probably null
R8868:Siae UTSW 9 37616836 missense probably damaging 1.00
R9014:Siae UTSW 9 37646343 missense possibly damaging 0.74
R9198:Siae UTSW 9 37627809 missense probably benign 0.05
R9447:Siae UTSW 9 37646447 missense probably benign 0.08
Z1176:Siae UTSW 9 37631469 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-06-20