Incidental Mutation 'R4301:Trim80'
Institutional Source Beutler Lab
Gene Symbol Trim80
Ensembl Gene ENSMUSG00000070332
Gene Nametripartite motif-containing 80
MMRRC Submission 041088-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4301 (G1)
Quality Score225
Status Validated
Chromosomal Location115440545-115448270 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 115445113 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093914]
Predicted Effect probably null
Transcript: ENSMUST00000093914
SMART Domains Protein: ENSMUSP00000091442
Gene: ENSMUSG00000070332

low complexity region 2 13 N/A INTRINSIC
RING 71 114 4.48e-7 SMART
Blast:BBOX 154 202 7e-22 BLAST
Pfam:zf-B_box 207 246 2.2e-10 PFAM
Blast:PRY 441 496 2e-18 BLAST
Pfam:SPRY 499 621 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175355
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T A 16: 56,556,903 V95D probably damaging Het
Adamtsl2 A G 2: 27,087,283 D252G probably null Het
Adgra3 T C 5: 49,961,078 R1043G possibly damaging Het
Atxn7l1 A G 12: 33,367,238 D562G probably damaging Het
Ccdc70 T C 8: 21,973,212 V6A possibly damaging Het
Cdc25a T C 9: 109,889,742 V337A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Crb1 A G 1: 139,248,830 S472P probably benign Het
Fam193b G A 13: 55,542,604 R740* probably null Het
Fer G T 17: 64,078,910 L292F probably damaging Het
Gmppa G A 1: 75,442,496 R349H possibly damaging Het
Hspa1a T C 17: 34,970,506 I474V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc30 A G 17: 67,632,568 S6P probably damaging Het
Lzts3 A G 2: 130,636,438 S133P probably damaging Het
Mkl2 T C 16: 13,398,305 Y294H probably damaging Het
Mtmr12 T A 15: 12,236,020 F122I possibly damaging Het
Mypn A G 10: 63,118,484 Y124H probably damaging Het
Nfat5 T C 8: 107,355,695 probably benign Het
Npr2 T C 4: 43,641,332 probably null Het
Olfr1441 T C 19: 12,422,717 L136P probably damaging Het
Pgm1 G A 5: 64,103,797 W51* probably null Het
Phip G A 9: 82,959,713 R48* probably null Het
Piezo2 T C 18: 63,084,840 T1075A probably damaging Het
Ppat G T 5: 76,928,501 probably benign Het
Ppp2r2b T A 18: 42,898,746 E23D probably null Het
Prickle1 T C 15: 93,508,636 I169V possibly damaging Het
Rab37 T A 11: 115,158,564 D95E possibly damaging Het
Sash1 A G 10: 8,751,470 V50A probably benign Het
Siae C A 9: 37,633,713 Q335K possibly damaging Het
Snx14 A T 9: 88,410,623 I217K probably damaging Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Sptb A G 12: 76,612,697 L1143S probably damaging Het
Trpm3 T C 19: 22,987,292 S1374P probably benign Het
Vldlr C A 19: 27,238,402 D266E possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zbtb10 A T 3: 9,265,160 Q526L probably damaging Het
Zfr2 T C 10: 81,242,184 probably benign Het
Zswim8 G A 14: 20,713,909 R449H possibly damaging Het
Zzef1 T C 11: 72,889,035 V1878A probably damaging Het
Other mutations in Trim80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Trim80 APN 11 115447665 missense probably benign 0.21
IGL00921:Trim80 APN 11 115447664 missense probably benign 0.00
IGL02948:Trim80 APN 11 115441593 missense possibly damaging 0.81
IGL03037:Trim80 APN 11 115441593 missense possibly damaging 0.81
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0409:Trim80 UTSW 11 115441213 missense probably damaging 1.00
R1069:Trim80 UTSW 11 115448083 missense probably damaging 1.00
R1832:Trim80 UTSW 11 115446793 missense probably benign
R1952:Trim80 UTSW 11 115441329 nonsense probably null
R2892:Trim80 UTSW 11 115448023 missense possibly damaging 0.81
R4748:Trim80 UTSW 11 115448138 missense possibly damaging 0.84
R4795:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4819:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4910:Trim80 UTSW 11 115446455 missense probably damaging 0.99
R5245:Trim80 UTSW 11 115441572 missense probably damaging 1.00
R5288:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5384:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5386:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5508:Trim80 UTSW 11 115445078 missense probably benign 0.06
R5645:Trim80 UTSW 11 115446785 missense probably damaging 1.00
R5785:Trim80 UTSW 11 115446475 nonsense probably null
R5822:Trim80 UTSW 11 115447921 missense probably damaging 0.99
R6754:Trim80 UTSW 11 115448174 missense probably damaging 1.00
R6785:Trim80 UTSW 11 115441201 missense probably damaging 0.99
R6788:Trim80 UTSW 11 115448017 missense probably benign 0.07
R7336:Trim80 UTSW 11 115441216 missense probably damaging 1.00
R8316:Trim80 UTSW 11 115441180 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-06-20