Incidental Mutation 'R4293:Actn3'
ID323193
Institutional Source Beutler Lab
Gene Symbol Actn3
Ensembl Gene ENSMUSG00000006457
Gene Nameactinin alpha 3
Synonyms
MMRRC Submission 041082-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R4293 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4861223-4877909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4865440 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 428 (E428G)
Ref Sequence ENSEMBL: ENSMUSP00000006626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]
Predicted Effect probably benign
Transcript: ENSMUST00000006626
AA Change: E428G

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457
AA Change: E428G

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119694
SMART Domains Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Inhibitor_I29 165 222 5.41e-16 SMART
Pept_C1 249 460 4.2e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138811
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase mitochondria density and a shift from anaerobic to aerobic metabolism in fast muscle fiber that is associated with increased aerobic capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef2 T C 2: 166,890,291 I1600T probably benign Het
Arid3b A T 9: 57,790,430 probably benign Het
Asgr2 C A 11: 70,098,231 T167K probably benign Het
Atf6b T A 17: 34,652,674 M428K probably benign Het
Atpaf1 A T 4: 115,788,359 M142L probably benign Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bms1 T C 6: 118,405,347 probably null Het
Brwd1 G A 16: 96,017,604 P1343S probably damaging Het
C330027C09Rik T A 16: 49,013,249 F571Y probably benign Het
Cdca2 T C 14: 67,714,850 D24G probably benign Het
Celsr2 T C 3: 108,393,677 R2767G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Ddx18 T C 1: 121,561,392 T309A probably benign Het
Dlg3 A T X: 100,796,682 probably benign Het
Fbf1 A G 11: 116,148,894 L713P probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fnbp1 A G 2: 31,105,350 F24S probably damaging Het
Gm16686 A T 4: 88,755,473 probably benign Het
Gmps A G 3: 63,990,619 M275V probably damaging Het
Igdcc4 A G 9: 65,124,610 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Lmf1 T C 17: 25,654,481 L320P probably damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Mettl18 A G 1: 163,996,602 D164G probably damaging Het
Myo5a A T 9: 75,144,171 T349S probably benign Het
Olfr1378 T C 11: 50,969,426 M136T probably damaging Het
Olfr926 A G 9: 38,877,313 I46V probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Pik3c3 G A 18: 30,343,990 A855T probably damaging Het
Plpp4 A G 7: 129,307,632 E22G probably damaging Het
Rev1 A T 1: 38,108,419 D13E possibly damaging Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Slc4a5 C T 6: 83,260,529 R165C probably damaging Het
Slfn10-ps T C 11: 83,035,434 noncoding transcript Het
Slfn9 T C 11: 82,982,508 N523S probably benign Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Stk32c T C 7: 139,120,788 probably null Het
Tenm3 T C 8: 48,395,658 T49A probably damaging Het
Tep1 T C 14: 50,846,861 I954V probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Vmn2r101 A T 17: 19,612,041 R766S probably damaging Het
Vwce A G 19: 10,659,632 T693A probably benign Het
Xpr1 A G 1: 155,312,796 F366S possibly damaging Het
Zfp317 A G 9: 19,646,694 probably null Het
Other mutations in Actn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
ballooned UTSW 19 4871848 missense probably damaging 1.00
PIT4480001:Actn3 UTSW 19 4867577 nonsense probably null
R0128:Actn3 UTSW 19 4871615 missense probably damaging 1.00
R1174:Actn3 UTSW 19 4864756 missense probably damaging 1.00
R1181:Actn3 UTSW 19 4872610 missense probably benign 0.07
R1239:Actn3 UTSW 19 4865455 unclassified probably benign
R1445:Actn3 UTSW 19 4865455 unclassified probably benign
R1698:Actn3 UTSW 19 4862207 missense possibly damaging 0.55
R2127:Actn3 UTSW 19 4871675 missense probably damaging 1.00
R4017:Actn3 UTSW 19 4867546 missense possibly damaging 0.95
R4482:Actn3 UTSW 19 4863408 critical splice donor site probably null
R4840:Actn3 UTSW 19 4864511 missense probably damaging 1.00
R4868:Actn3 UTSW 19 4864454 missense probably benign 0.24
R5152:Actn3 UTSW 19 4863544 missense probably damaging 1.00
R5349:Actn3 UTSW 19 4867958 missense possibly damaging 0.94
R5420:Actn3 UTSW 19 4865344 frame shift probably null
R5448:Actn3 UTSW 19 4863211 missense possibly damaging 0.94
R5563:Actn3 UTSW 19 4872316 missense probably damaging 1.00
R5753:Actn3 UTSW 19 4864567 critical splice acceptor site probably null
R6457:Actn3 UTSW 19 4871848 missense probably damaging 1.00
R7236:Actn3 UTSW 19 4871616 missense probably benign 0.07
R7470:Actn3 UTSW 19 4867814 missense possibly damaging 0.87
R8232:Actn3 UTSW 19 4871655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGCAACCACTTGTTTACC -3'
(R):5'- AGCAAAGGTCATCCTAGCCG -3'

Sequencing Primer
(F):5'- TTTACCAAGGGTCTGAGGGAG -3'
(R):5'- CGGTGCTGGGTCAGGGAATAC -3'
Posted On2015-06-20