Incidental Mutation 'R4384:Myh9'
ID326132
Institutional Source Beutler Lab
Gene Symbol Myh9
Ensembl Gene ENSMUSG00000022443
Gene Namemyosin, heavy polypeptide 9, non-muscle
SynonymsNMHC II-A, D0Jmb2, myosin IIA, Fltn, Myhn1, Myhn-1, E030044M24Rik
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location77760587-77842175 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 77791712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016771] [ENSMUST00000123101]
Predicted Effect probably benign
Transcript: ENSMUST00000016771
SMART Domains Protein: ENSMUSP00000016771
Gene: ENSMUSG00000022443

DomainStartEndE-ValueType
Pfam:Myosin_N 29 69 3.4e-11 PFAM
MYSc 75 777 N/A SMART
IQ 778 800 1.46e-3 SMART
Pfam:Myosin_tail_1 841 1921 N/A PFAM
low complexity region 1948 1959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123101
SMART Domains Protein: ENSMUSP00000116198
Gene: ENSMUSG00000022443

DomainStartEndE-ValueType
Pfam:Myosin_N 29 71 6.8e-15 PFAM
Pfam:Myosin_head 83 114 5.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129453
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display hearing loss with incomplete penetrance. Mice homozygous or heterozygous for one of several knock-in alleles exhibit macrothrombocytopenia, nephritis, cataracts and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Myh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Myh9 APN 15 77796995 splice site probably benign
IGL01105:Myh9 APN 15 77781478 missense probably benign 0.01
IGL01137:Myh9 APN 15 77769542 missense probably benign 0.19
IGL01399:Myh9 APN 15 77767270 missense probably damaging 1.00
IGL01666:Myh9 APN 15 77761931 missense probably benign 0.31
IGL01832:Myh9 APN 15 77791753 missense probably benign 0.02
IGL01933:Myh9 APN 15 77781218 missense probably benign 0.00
IGL02049:Myh9 APN 15 77769870 missense probably benign 0.01
IGL02237:Myh9 APN 15 77786654 missense probably benign 0.03
IGL02243:Myh9 APN 15 77767482 missense probably damaging 1.00
IGL02248:Myh9 APN 15 77786614 missense probably damaging 0.99
IGL02292:Myh9 APN 15 77807996 missense probably damaging 1.00
IGL02315:Myh9 APN 15 77769973 missense probably benign 0.00
IGL02427:Myh9 APN 15 77775804 missense probably damaging 0.98
IGL02675:Myh9 APN 15 77788930 missense possibly damaging 0.89
IGL02727:Myh9 APN 15 77791742 missense probably benign 0.11
IGL02749:Myh9 APN 15 77807986 nonsense probably null
IGL02887:Myh9 APN 15 77796020 nonsense probably null
IGL02926:Myh9 APN 15 77787626 missense probably damaging 1.00
IGL02945:Myh9 APN 15 77762005 missense probably benign 0.05
IGL03137:Myh9 APN 15 77791089 missense probably damaging 1.00
R0784:Myh9 UTSW 15 77777009 splice site probably benign
R1375:Myh9 UTSW 15 77769368 splice site probably null
R1535:Myh9 UTSW 15 77777813 missense probably damaging 0.98
R1563:Myh9 UTSW 15 77771857 missense probably damaging 0.99
R1629:Myh9 UTSW 15 77764401 missense probably damaging 1.00
R1635:Myh9 UTSW 15 77771167 missense probably benign 0.06
R1635:Myh9 UTSW 15 77775899 missense probably benign 0.00
R1693:Myh9 UTSW 15 77812897 missense probably damaging 1.00
R1791:Myh9 UTSW 15 77773264 unclassified probably benign
R2010:Myh9 UTSW 15 77771947 missense probably benign 0.06
R2048:Myh9 UTSW 15 77771132 missense possibly damaging 0.70
R2078:Myh9 UTSW 15 77763912 missense probably benign 0.16
R2092:Myh9 UTSW 15 77764350 nonsense probably null
R2376:Myh9 UTSW 15 77783417 missense probably benign 0.18
R2922:Myh9 UTSW 15 77813184 missense probably damaging 1.00
R3709:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3710:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3737:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3738:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3739:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R4299:Myh9 UTSW 15 77769964 missense probably benign
R4514:Myh9 UTSW 15 77764000 missense probably benign
R4631:Myh9 UTSW 15 77797028 missense probably damaging 0.99
R4642:Myh9 UTSW 15 77761951 missense probably benign 0.10
R4695:Myh9 UTSW 15 77768853 missense probably damaging 0.99
R4709:Myh9 UTSW 15 77787517 missense probably damaging 1.00
R4766:Myh9 UTSW 15 77807877 missense probably damaging 0.97
R4826:Myh9 UTSW 15 77788946 nonsense probably null
R4842:Myh9 UTSW 15 77769253 missense probably damaging 0.99
R4946:Myh9 UTSW 15 77773340 missense probably damaging 1.00
R5030:Myh9 UTSW 15 77807798 intron probably benign
R5055:Myh9 UTSW 15 77764523 missense probably benign 0.12
R5202:Myh9 UTSW 15 77781110 critical splice donor site probably null
R5413:Myh9 UTSW 15 77807986 nonsense probably null
R5435:Myh9 UTSW 15 77769609 missense probably benign 0.00
R5701:Myh9 UTSW 15 77791764 missense probably benign 0.00
R5757:Myh9 UTSW 15 77771162 missense probably benign 0.44
R5793:Myh9 UTSW 15 77768877 missense probably benign 0.23
R5952:Myh9 UTSW 15 77773332 missense possibly damaging 0.65
R6248:Myh9 UTSW 15 77785222 nonsense probably null
R6648:Myh9 UTSW 15 77766772 missense probably benign 0.08
R7055:Myh9 UTSW 15 77775198 missense probably damaging 1.00
R7106:Myh9 UTSW 15 77775121 missense probably benign
R7180:Myh9 UTSW 15 77807910 missense probably benign 0.00
R7205:Myh9 UTSW 15 77783472 missense probably benign 0.08
R7254:Myh9 UTSW 15 77765824 missense probably damaging 1.00
R7284:Myh9 UTSW 15 77787596 missense probably damaging 1.00
R7417:Myh9 UTSW 15 77763865 nonsense probably null
R7695:Myh9 UTSW 15 77766736 missense probably benign 0.31
R7750:Myh9 UTSW 15 77783410 missense probably benign 0.01
Z1088:Myh9 UTSW 15 77775258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCTGGGTCACATTTCTAG -3'
(R):5'- CGATCAGCCTAGTACCTATGTTGG -3'

Sequencing Primer
(F):5'- TGGGTCACATTTCTAGTCAGC -3'
(R):5'- AGCCTAGTACCTATGTTGGCTCAG -3'
Posted On2015-07-06