Incidental Mutation 'R4430:Pde3b'
ID328566
Institutional Source Beutler Lab
Gene Symbol Pde3b
Ensembl Gene ENSMUSG00000030671
Gene Namephosphodiesterase 3B, cGMP-inhibited
Synonyms
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4430 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location114415281-114539251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114534670 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 974 (P974S)
Ref Sequence ENSEMBL: ENSMUSP00000032909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032909]
Predicted Effect probably damaging
Transcript: ENSMUST00000032909
AA Change: P974S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032909
Gene: ENSMUSG00000030671
AA Change: P974S

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
HDc 710 927 7.52e-4 SMART
low complexity region 991 1023 N/A INTRINSIC
low complexity region 1048 1067 N/A INTRINSIC
low complexity region 1081 1096 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149455
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutants show abnormalities in glycerol and fatty acid levels, along with changes in adipocyte morphology and decreased body fat percentage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Pde3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Pde3b APN 7 114518410 missense probably benign 0.00
IGL01637:Pde3b APN 7 114526901 nonsense probably null
IGL02004:Pde3b APN 7 114519617 missense possibly damaging 0.67
IGL02113:Pde3b APN 7 114526906 missense probably damaging 1.00
IGL02201:Pde3b APN 7 114534608 missense probably damaging 1.00
IGL02266:Pde3b APN 7 114526966 missense probably damaging 1.00
IGL02601:Pde3b APN 7 114523342 missense probably damaging 1.00
IGL02641:Pde3b APN 7 114530817 missense probably damaging 1.00
IGL02671:Pde3b APN 7 114523345 missense possibly damaging 0.77
IGL02691:Pde3b APN 7 114508085 splice site probably benign
IGL02719:Pde3b APN 7 114506248 missense probably damaging 1.00
IGL03092:Pde3b APN 7 114523348 missense probably damaging 1.00
FR4342:Pde3b UTSW 7 114534775 small insertion probably benign
R0208:Pde3b UTSW 7 114497981 missense probably benign 0.00
R1191:Pde3b UTSW 7 114519575 missense probably benign 0.01
R1514:Pde3b UTSW 7 114530766 missense probably damaging 0.98
R1612:Pde3b UTSW 7 114519556 nonsense probably null
R2081:Pde3b UTSW 7 114523422 missense probably benign
R2433:Pde3b UTSW 7 114526837 missense probably benign 0.30
R2508:Pde3b UTSW 7 114526857 nonsense probably null
R3842:Pde3b UTSW 7 114526867 missense probably damaging 1.00
R4082:Pde3b UTSW 7 114494588 missense probably benign 0.04
R4115:Pde3b UTSW 7 114521727 missense probably damaging 1.00
R4197:Pde3b UTSW 7 114530872 splice site probably benign
R4236:Pde3b UTSW 7 114521688 missense possibly damaging 0.62
R4355:Pde3b UTSW 7 114416287 missense probably benign
R4411:Pde3b UTSW 7 114534749 small deletion probably benign
R4901:Pde3b UTSW 7 114508190 missense probably damaging 0.99
R4969:Pde3b UTSW 7 114519612 missense possibly damaging 0.92
R5314:Pde3b UTSW 7 114494537 missense probably damaging 1.00
R5346:Pde3b UTSW 7 114506190 missense probably benign 0.00
R5706:Pde3b UTSW 7 114521692 missense probably damaging 1.00
R5844:Pde3b UTSW 7 114508871 missense probably benign 0.01
R6014:Pde3b UTSW 7 114416440 missense probably damaging 1.00
R6048:Pde3b UTSW 7 114508267 missense probably benign 0.00
R6190:Pde3b UTSW 7 114523032 intron probably null
R7220:Pde3b UTSW 7 114536062 missense probably damaging 0.97
R7239:Pde3b UTSW 7 114416149 missense probably damaging 0.99
R7818:Pde3b UTSW 7 114491440 missense probably damaging 0.99
R7869:Pde3b UTSW 7 114494687 missense probably benign 0.03
R7952:Pde3b UTSW 7 114494687 missense probably benign 0.03
RF051:Pde3b UTSW 7 114534775 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACCGAGTCAGTAATGTTTTGAGG -3'
(R):5'- AGGAGTTACTCAACATATCTGTACC -3'

Sequencing Primer
(F):5'- ACCTTTAATCCCAGGGTTCAGGAG -3'
(R):5'- CCTTCGGGATAGCATTGAAAATG -3'
Posted On2015-07-21