Incidental Mutation 'R5706:Pde3b'
ID451975
Institutional Source Beutler Lab
Gene Symbol Pde3b
Ensembl Gene ENSMUSG00000030671
Gene Namephosphodiesterase 3B, cGMP-inhibited
Synonyms
MMRRC Submission 043331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5706 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location114415281-114539251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114521692 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 684 (G684D)
Ref Sequence ENSEMBL: ENSMUSP00000032909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032909]
Predicted Effect probably damaging
Transcript: ENSMUST00000032909
AA Change: G684D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032909
Gene: ENSMUSG00000030671
AA Change: G684D

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
HDc 710 927 7.52e-4 SMART
low complexity region 991 1023 N/A INTRINSIC
low complexity region 1048 1067 N/A INTRINSIC
low complexity region 1081 1096 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149455
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutants show abnormalities in glycerol and fatty acid levels, along with changes in adipocyte morphology and decreased body fat percentage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,054,261 M77K probably benign Het
Amy1 A G 3: 113,556,120 V467A probably damaging Het
Atf4 T C 15: 80,256,330 V11A possibly damaging Het
B4galt1 T C 4: 40,807,268 N373D probably damaging Het
Bpifa3 A G 2: 154,135,578 K112R probably damaging Het
Chd2 T A 7: 73,491,357 Y596F possibly damaging Het
Clspn T C 4: 126,578,418 S962P probably damaging Het
Cyp2c68 T C 19: 39,734,318 D262G possibly damaging Het
Dcaf11 T C 14: 55,565,695 I282T probably damaging Het
Dmxl1 T C 18: 49,957,395 probably null Het
Dnah11 T G 12: 118,023,935 K2411Q probably damaging Het
Elf3 A G 1: 135,256,482 V196A probably benign Het
Fhad1 T G 4: 141,954,116 T538P probably damaging Het
Fkbp10 A G 11: 100,421,023 D174G probably damaging Het
Gas6 A G 8: 13,477,098 S217P probably damaging Het
Gm4778 T A 3: 94,266,652 H322Q possibly damaging Het
Heatr5b C T 17: 78,766,875 probably null Het
Iqgap3 A G 3: 88,115,908 E502G probably benign Het
Klc1 T C 12: 111,795,627 V577A possibly damaging Het
Lck T C 4: 129,551,638 probably null Het
Mc3r C A 2: 172,249,690 Y277* probably null Het
Mlxipl T C 5: 135,133,604 V640A probably benign Het
Mrc2 A T 11: 105,332,343 N471Y probably damaging Het
Ncan T A 8: 70,102,017 H1050L probably damaging Het
Nrl C A 14: 55,522,432 V13F probably damaging Het
Obscn T A 11: 59,076,256 Y546F probably damaging Het
Olfr214 A G 6: 116,557,113 I229M probably damaging Het
Olfr654 T G 7: 104,587,890 S46A probably benign Het
Olfr799 A G 10: 129,648,091 probably null Het
Prkaa1 C T 15: 5,174,342 T244I probably benign Het
Scfd2 A T 5: 74,206,398 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smg1 A T 7: 118,145,590 V3113D possibly damaging Het
Sorbs1 T C 19: 40,376,881 T153A probably benign Het
Spag16 A G 1: 69,870,289 T182A probably benign Het
Svs2 T C 2: 164,237,669 K106R possibly damaging Het
Tenm1 A G X: 43,074,695 V107A possibly damaging Het
Topaz1 A T 9: 122,799,485 I1546F possibly damaging Het
Tubgcp2 C A 7: 140,032,225 E78* probably null Het
Vars A G 17: 35,005,481 probably null Het
Vmn2r109 A T 17: 20,554,305 W263R probably benign Het
Other mutations in Pde3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Pde3b APN 7 114518410 missense probably benign 0.00
IGL01637:Pde3b APN 7 114526901 nonsense probably null
IGL02004:Pde3b APN 7 114519617 missense possibly damaging 0.67
IGL02113:Pde3b APN 7 114526906 missense probably damaging 1.00
IGL02201:Pde3b APN 7 114534608 missense probably damaging 1.00
IGL02266:Pde3b APN 7 114526966 missense probably damaging 1.00
IGL02601:Pde3b APN 7 114523342 missense probably damaging 1.00
IGL02641:Pde3b APN 7 114530817 missense probably damaging 1.00
IGL02671:Pde3b APN 7 114523345 missense possibly damaging 0.77
IGL02691:Pde3b APN 7 114508085 splice site probably benign
IGL02719:Pde3b APN 7 114506248 missense probably damaging 1.00
IGL03092:Pde3b APN 7 114523348 missense probably damaging 1.00
FR4342:Pde3b UTSW 7 114534775 small insertion probably benign
R0208:Pde3b UTSW 7 114497981 missense probably benign 0.00
R1191:Pde3b UTSW 7 114519575 missense probably benign 0.01
R1514:Pde3b UTSW 7 114530766 missense probably damaging 0.98
R1612:Pde3b UTSW 7 114519556 nonsense probably null
R2081:Pde3b UTSW 7 114523422 missense probably benign
R2433:Pde3b UTSW 7 114526837 missense probably benign 0.30
R2508:Pde3b UTSW 7 114526857 nonsense probably null
R3842:Pde3b UTSW 7 114526867 missense probably damaging 1.00
R4082:Pde3b UTSW 7 114494588 missense probably benign 0.04
R4115:Pde3b UTSW 7 114521727 missense probably damaging 1.00
R4197:Pde3b UTSW 7 114530872 splice site probably benign
R4236:Pde3b UTSW 7 114521688 missense possibly damaging 0.62
R4355:Pde3b UTSW 7 114416287 missense probably benign
R4411:Pde3b UTSW 7 114534749 small deletion probably benign
R4430:Pde3b UTSW 7 114534670 missense probably damaging 1.00
R4901:Pde3b UTSW 7 114508190 missense probably damaging 0.99
R4969:Pde3b UTSW 7 114519612 missense possibly damaging 0.92
R5314:Pde3b UTSW 7 114494537 missense probably damaging 1.00
R5346:Pde3b UTSW 7 114506190 missense probably benign 0.00
R5844:Pde3b UTSW 7 114508871 missense probably benign 0.01
R6014:Pde3b UTSW 7 114416440 missense probably damaging 1.00
R6048:Pde3b UTSW 7 114508267 missense probably benign 0.00
R6190:Pde3b UTSW 7 114523032 intron probably null
R7220:Pde3b UTSW 7 114536062 missense probably damaging 0.97
R7239:Pde3b UTSW 7 114416149 missense probably damaging 0.99
R7818:Pde3b UTSW 7 114491440 missense probably damaging 0.99
R7869:Pde3b UTSW 7 114494687 missense probably benign 0.03
RF051:Pde3b UTSW 7 114534775 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATAGAGTTCTTGCCTGACATTTGGG -3'
(R):5'- GTCAGTTATTAACACCAGGTAACAG -3'

Sequencing Primer
(F):5'- CCTGACATTTGGGAGGCCTG -3'
(R):5'- CCAGGTATACCATTACTCACAT -3'
Posted On2017-01-03