Incidental Mutation 'R4692:Olfr895'
ID354979
Institutional Source Beutler Lab
Gene Symbol Olfr895
Ensembl Gene ENSMUSG00000096427
Gene Nameolfactory receptor 895
SynonymsMOR170-1, GA_x6K02T2PVTD-31962461-31963411
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38267851-38269735 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 38268530 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 6 (Q6*)
Ref Sequence ENSEMBL: ENSMUSP00000091387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093864] [ENSMUST00000212156]
Predicted Effect probably null
Transcript: ENSMUST00000093864
AA Change: Q6*
SMART Domains Protein: ENSMUSP00000091387
Gene: ENSMUSG00000096427
AA Change: Q6*

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 4.6e-47 PFAM
Pfam:7tm_1 47 246 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212156
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Olfr895
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Olfr895 APN 9 38268505 splice site probably benign
IGL01477:Olfr895 APN 9 38269319 missense possibly damaging 0.74
IGL02150:Olfr895 APN 9 38269268 missense possibly damaging 0.56
R0616:Olfr895 UTSW 9 38269334 missense probably benign 0.08
R0738:Olfr895 UTSW 9 38269125 missense possibly damaging 0.93
R3155:Olfr895 UTSW 9 38268540 start codon destroyed probably null 0.98
R3824:Olfr895 UTSW 9 38268518 missense probably benign
R3825:Olfr895 UTSW 9 38268518 missense probably benign
R4023:Olfr895 UTSW 9 38269461 missense possibly damaging 0.83
R4687:Olfr895 UTSW 9 38269414 missense probably damaging 1.00
R6171:Olfr895 UTSW 9 38268602 nonsense probably null
R6736:Olfr895 UTSW 9 38268570 missense probably damaging 1.00
R6950:Olfr895 UTSW 9 38268546 missense probably damaging 1.00
R7256:Olfr895 UTSW 9 38268708 missense probably damaging 0.98
R7774:Olfr895 UTSW 9 38269359 missense probably damaging 0.99
R7937:Olfr895 UTSW 9 38269048 missense probably benign 0.16
Z1088:Olfr895 UTSW 9 38268612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAGCATCTTTCTGAAGTG -3'
(R):5'- AGCCCATCAGCATTTTGGG -3'

Sequencing Primer
(F):5'- CCAGCATCTTTCTGAAGTGTTATAC -3'
(R):5'- CCCATCAGCATTTTGGGGGTAAAG -3'
Posted On2015-10-21