Incidental Mutation 'R4692:Arhgap20'
ID354980
Institutional Source Beutler Lab
Gene Symbol Arhgap20
Ensembl Gene ENSMUSG00000053199
Gene NameRho GTPase activating protein 20
Synonyms6530403F17Rik, A530023E23Rik
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location51765337-51853856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51785788 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000065633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065496] [ENSMUST00000130405]
Predicted Effect probably damaging
Transcript: ENSMUST00000065496
AA Change: D53G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065633
Gene: ENSMUSG00000053199
AA Change: D53G

DomainStartEndE-ValueType
PH 86 187 3.31e-5 SMART
Pfam:RA 194 283 3.6e-15 PFAM
RhoGAP 374 548 1.27e-41 SMART
internal_repeat_1 655 779 9.97e-15 PROSPERO
internal_repeat_1 797 922 9.97e-15 PROSPERO
low complexity region 935 962 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124907
Predicted Effect probably damaging
Transcript: ENSMUST00000130405
AA Change: D17G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120124
Gene: ENSMUSG00000053199
AA Change: D17G

DomainStartEndE-ValueType
PH 50 151 3.31e-5 SMART
Pfam:RA 158 247 3.3e-14 PFAM
RhoGAP 338 512 1.27e-41 SMART
internal_repeat_1 619 743 7.07e-15 PROSPERO
internal_repeat_1 761 886 7.07e-15 PROSPERO
low complexity region 899 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146509
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of RHO-type GTPases, transducing a signal from RAP1 to RHO and impacting neurite outgrowth. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Arhgap20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Arhgap20 APN 9 51849413 missense probably benign 0.00
IGL01542:Arhgap20 APN 9 51838887 missense probably benign
IGL01815:Arhgap20 APN 9 51846168 missense probably damaging 1.00
IGL01975:Arhgap20 APN 9 51849797 nonsense probably null
IGL02041:Arhgap20 APN 9 51846190 missense possibly damaging 0.92
IGL02557:Arhgap20 APN 9 51821273 missense probably damaging 1.00
IGL02602:Arhgap20 APN 9 51825843 missense probably damaging 1.00
IGL02741:Arhgap20 APN 9 51848645 missense probably benign 0.17
IGL02792:Arhgap20 APN 9 51849918 missense possibly damaging 0.89
IGL03166:Arhgap20 APN 9 51849777 missense possibly damaging 0.63
P0047:Arhgap20 UTSW 9 51849236 missense probably damaging 1.00
R0115:Arhgap20 UTSW 9 51838972 missense probably damaging 1.00
R0121:Arhgap20 UTSW 9 51838951 missense possibly damaging 0.91
R0539:Arhgap20 UTSW 9 51850155 missense probably benign 0.01
R0541:Arhgap20 UTSW 9 51849663 missense probably damaging 1.00
R0551:Arhgap20 UTSW 9 51825825 splice site probably benign
R0570:Arhgap20 UTSW 9 51840451 missense possibly damaging 0.56
R0630:Arhgap20 UTSW 9 51849384 missense probably damaging 0.98
R0931:Arhgap20 UTSW 9 51816741 missense probably benign 0.30
R0992:Arhgap20 UTSW 9 51816786 missense probably damaging 0.96
R1052:Arhgap20 UTSW 9 51846270 missense probably damaging 0.98
R1779:Arhgap20 UTSW 9 51849915 missense probably benign
R1839:Arhgap20 UTSW 9 51849326 missense probably damaging 0.99
R1942:Arhgap20 UTSW 9 51831698 missense probably benign 0.43
R2292:Arhgap20 UTSW 9 51849443 missense possibly damaging 0.63
R3896:Arhgap20 UTSW 9 51816837 missense probably damaging 0.96
R4109:Arhgap20 UTSW 9 51816685 missense possibly damaging 0.60
R4166:Arhgap20 UTSW 9 51826835 critical splice acceptor site probably null
R4631:Arhgap20 UTSW 9 51840353 intron probably benign
R5273:Arhgap20 UTSW 9 51848616 missense probably damaging 1.00
R5505:Arhgap20 UTSW 9 51838948 missense probably damaging 0.98
R5743:Arhgap20 UTSW 9 51816727 missense probably benign 0.17
R5847:Arhgap20 UTSW 9 51824976 intron probably benign
R6006:Arhgap20 UTSW 9 51850126 missense probably benign
R6112:Arhgap20 UTSW 9 51829384 missense probably damaging 1.00
R6355:Arhgap20 UTSW 9 51843720 missense probably damaging 1.00
R6576:Arhgap20 UTSW 9 51849278 missense probably benign 0.03
R6801:Arhgap20 UTSW 9 51848592 missense probably damaging 1.00
R7130:Arhgap20 UTSW 9 51849747 missense probably damaging 0.98
R7318:Arhgap20 UTSW 9 51840502 missense probably benign
R7347:Arhgap20 UTSW 9 51849035 missense probably benign 0.07
R7500:Arhgap20 UTSW 9 51840502 missense probably benign
R7598:Arhgap20 UTSW 9 51849790 missense possibly damaging 0.95
R7677:Arhgap20 UTSW 9 51840398 missense probably damaging 0.97
R7725:Arhgap20 UTSW 9 51831750 missense possibly damaging 0.80
R8086:Arhgap20 UTSW 9 51849263 missense probably benign 0.00
R8122:Arhgap20 UTSW 9 51849993 missense probably damaging 0.99
R8125:Arhgap20 UTSW 9 51826909 missense probably damaging 0.99
R8196:Arhgap20 UTSW 9 51848977 missense possibly damaging 0.94
Z1177:Arhgap20 UTSW 9 51824924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAACGGCTTGTACCTCACG -3'
(R):5'- AGAATGTCACAGGTCACAATTCC -3'

Sequencing Primer
(F):5'- CCTAAAGGTGGCTGCTTTAGATCC -3'
(R):5'- TCCTATCACCAAGAAAATGCTGGTG -3'
Posted On2015-10-21