Incidental Mutation 'R0280:Dyrk1b'
ID 37451
Institutional Source Beutler Lab
Gene Symbol Dyrk1b
Ensembl Gene ENSMUSG00000002409
Gene Name dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b
Synonyms Mirk
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0280 (G1)
Quality Score 179
Status Validated
Chromosome 7
Chromosomal Location 28179469-28187294 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28184312 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 198 (Y198H)
Ref Sequence ENSEMBL: ENSMUSP00000133719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085901] [ENSMUST00000172467] [ENSMUST00000172761]
AlphaFold Q9Z188
Predicted Effect probably damaging
Transcript: ENSMUST00000085901
AA Change: Y198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409
AA Change: Y198H

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172467
AA Change: Y258H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133431
Gene: ENSMUSG00000002409
AA Change: Y258H

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172761
AA Change: Y198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409
AA Change: Y198H

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 391 1.52e-78 SMART
low complexity region 398 414 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
low complexity region 502 521 N/A INTRINSIC
low complexity region 531 551 N/A INTRINSIC
low complexity region 557 575 N/A INTRINSIC
Meta Mutation Damage Score 0.8503 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Dyrk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dyrk1b APN 7 28182676 missense probably damaging 0.96
IGL01820:Dyrk1b APN 7 28181600 utr 5 prime probably benign
IGL03155:Dyrk1b APN 7 28182687 missense probably benign 0.25
R0323:Dyrk1b UTSW 7 28185356 missense probably benign 0.00
R0610:Dyrk1b UTSW 7 28186634 missense probably damaging 0.99
R0765:Dyrk1b UTSW 7 28185711 intron probably benign
R1858:Dyrk1b UTSW 7 28182646 splice site probably null
R2354:Dyrk1b UTSW 7 28185372 missense possibly damaging 0.79
R4599:Dyrk1b UTSW 7 28182431 missense probably damaging 1.00
R4655:Dyrk1b UTSW 7 28185751 missense probably damaging 0.97
R5201:Dyrk1b UTSW 7 28185096 missense probably damaging 1.00
R5357:Dyrk1b UTSW 7 28185318 missense possibly damaging 0.79
R5560:Dyrk1b UTSW 7 28184253 missense possibly damaging 0.53
R6171:Dyrk1b UTSW 7 28186550 critical splice acceptor site probably null
R6751:Dyrk1b UTSW 7 28186709 missense probably damaging 1.00
R6901:Dyrk1b UTSW 7 28185117 missense probably damaging 1.00
R6918:Dyrk1b UTSW 7 28185925 missense probably damaging 0.99
R7699:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R7700:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R8177:Dyrk1b UTSW 7 28183176 missense possibly damaging 0.86
R8271:Dyrk1b UTSW 7 28182655 missense probably benign 0.02
R9241:Dyrk1b UTSW 7 28186633 missense probably benign 0.00
X0060:Dyrk1b UTSW 7 28183150 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGCCTTGGAAGTCCAGTGAGTTG -3'
(R):5'- CGAAGTCCACGATCTTGATGGCAC -3'

Sequencing Primer
(F):5'- TCCAGTGAGTTGGTGTAGAAAC -3'
(R):5'- CTTGATGGCACTGCGCTTG -3'
Posted On 2013-05-23