Mutagenetix > Incidental Mutations

Incidental Mutation 'R0280:Dyrk1b'

37451

Institutional Source

Beutler Lab

Gene Symbol

Dyrk1b

Ensembl Gene

ENSMUSG00000002409

Gene Name

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b

Synonyms

Mirk

MMRRC Submission

038502-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0280 (G1)

Quality Score

179

Status

Validated

Chromosome

Chromosomal Location

28179469-28187294 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 28184312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 198 (Y198H)

Ref Sequence

ENSEMBL: ENSMUSP00000133719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085901] [ENSMUST00000172467] [ENSMUST00000172761]

AlphaFold

Q9Z188

Predicted Effect

probably damaging
Transcript: ENSMUST00000085901
AA Change: Y198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409
AA Change: Y198H

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
low complexity region	22	41	N/A	INTRINSIC
S_TKc	111	431	3.75e-78	SMART
low complexity region	438	454	N/A	INTRINSIC
low complexity region	460	477	N/A	INTRINSIC
low complexity region	542	561	N/A	INTRINSIC
low complexity region	571	591	N/A	INTRINSIC
low complexity region	597	615	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172467
AA Change: Y258H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133431
Gene: ENSMUSG00000002409
AA Change: Y258H

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
low complexity region	22	41	N/A	INTRINSIC
S_TKc	111	431	3.75e-78	SMART
low complexity region	438	454	N/A	INTRINSIC
low complexity region	460	477	N/A	INTRINSIC
low complexity region	542	561	N/A	INTRINSIC
low complexity region	571	591	N/A	INTRINSIC
low complexity region	597	615	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172761
AA Change: Y198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409
AA Change: Y198H

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
low complexity region	22	41	N/A	INTRINSIC
S_TKc	111	391	1.52e-78	SMART
low complexity region	398	414	N/A	INTRINSIC
low complexity region	420	437	N/A	INTRINSIC
low complexity region	502	521	N/A	INTRINSIC
low complexity region	531	551	N/A	INTRINSIC
low complexity region	557	575	N/A	INTRINSIC

Meta Mutation Damage Score

0.8503

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ankrd16	T	G	2: 11,781,501	V187G	probably damaging	Het
AU019823	T	C	9: 50,609,379	T123A	probably damaging	Het
Ccdc110	A	T	8: 45,943,450	N793Y	probably benign	Het
Ccdc170	T	C	10: 4,558,663	I629T	possibly damaging	Het
Clcn6	A	G	4: 148,008,715	L836P	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crocc	T	C	4: 141,028,426	E1097G	probably damaging	Het
Csmd1	A	T	8: 16,271,602	V494E	probably damaging	Het
Drg1	A	T	11: 3,256,537		probably null	Het
Dscam	T	C	16: 97,039,006	K134E	possibly damaging	Het
Esr1	A	G	10: 4,856,951	D289G	probably benign	Het
Esr1	G	T	10: 4,939,289	V396F	probably damaging	Het
Evi5l	T	C	8: 4,193,133	V339A	probably damaging	Het
Fat4	A	T	3: 38,890,816	Q1286L	probably benign	Het
Frem1	T	C	4: 82,969,444	H1118R	probably damaging	Het
Fuk	A	T	8: 110,894,748	V188D	probably damaging	Het
Fut9	C	T	4: 25,619,852	D321N	probably benign	Het
Gaa	T	G	11: 119,284,547	V917G	probably damaging	Het
Gm973	GCC	GC	1: 59,544,680		probably null	Het
Kidins220	A	G	12: 25,010,141	T767A	probably damaging	Het
Kif7	A	G	7: 79,698,823	S1257P	probably benign	Het
Ltn1	A	G	16: 87,397,838	L1391P	probably damaging	Het
Mast3	A	G	8: 70,783,795	Y681H	probably damaging	Het
Mast3	A	G	8: 70,787,920	V291A	possibly damaging	Het
Metrn	C	T	17: 25,795,135	R239H	probably benign	Het
Mphosph10	C	A	7: 64,376,703	K666N	possibly damaging	Het
Mtbp	C	T	15: 55,586,461	T433I	probably benign	Het
Mtmr2	A	G	9: 13,799,249	K365E	probably damaging	Het
Nanog	A	G	6: 122,713,398	D229G	probably damaging	Het
Npepps	T	C	11: 97,241,014	N338S	possibly damaging	Het
Nphp4	T	A	4: 152,551,936		probably benign	Het
Olfr1279	T	C	2: 111,307,072	F289S	possibly damaging	Het
Plcl2	A	G	17: 50,607,034	E357G	probably damaging	Het
Polb	A	T	8: 22,640,392	Y173N	probably damaging	Het
R3hdm1	T	A	1: 128,162,775	S74T	probably benign	Het
Raet1d	T	A	10: 22,370,883	C37S	probably damaging	Het
Reln	G	A	5: 22,227,513		probably benign	Het
Rps6kc1	T	C	1: 190,809,000	S369G	probably damaging	Het
Sgf29	A	G	7: 126,671,571	E108G	probably benign	Het
Sh3tc1	A	G	5: 35,706,017	L942P	probably damaging	Het
Slc22a27	A	T	19: 7,896,822	L188*	probably null	Het
Slc9a3	T	A	13: 74,159,424	I445N	probably damaging	Het
Sufu	A	T	19: 46,450,673		probably benign	Het
Tomm40	G	A	7: 19,713,751	T118I	probably damaging	Het
Ttc25	A	T	11: 100,550,265	K107N	probably damaging	Het
Ttn	C	T	2: 76,740,479	R26690H	probably damaging	Het
Vmn2r16	A	G	5: 109,340,139	I293V	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vsig8	A	G	1: 172,561,538	D119G	probably benign	Het

Other mutations in Dyrk1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01483:Dyrk1b	APN	7	28182676	missense	probably damaging	0.96
IGL01820:Dyrk1b	APN	7	28181600	utr 5 prime	probably benign
IGL03155:Dyrk1b	APN	7	28182687	missense	probably benign	0.25
R0323:Dyrk1b	UTSW	7	28185356	missense	probably benign	0.00
R0610:Dyrk1b	UTSW	7	28186634	missense	probably damaging	0.99
R0765:Dyrk1b	UTSW	7	28185711	intron	probably benign
R1858:Dyrk1b	UTSW	7	28182646	splice site	probably null
R2354:Dyrk1b	UTSW	7	28185372	missense	possibly damaging	0.79
R4599:Dyrk1b	UTSW	7	28182431	missense	probably damaging	1.00
R4655:Dyrk1b	UTSW	7	28185751	missense	probably damaging	0.97
R5201:Dyrk1b	UTSW	7	28185096	missense	probably damaging	1.00
R5357:Dyrk1b	UTSW	7	28185318	missense	possibly damaging	0.79
R5560:Dyrk1b	UTSW	7	28184253	missense	possibly damaging	0.53
R6171:Dyrk1b	UTSW	7	28186550	critical splice acceptor site	probably null
R6751:Dyrk1b	UTSW	7	28186709	missense	probably damaging	1.00
R6901:Dyrk1b	UTSW	7	28185117	missense	probably damaging	1.00
R6918:Dyrk1b	UTSW	7	28185925	missense	probably damaging	0.99
R7699:Dyrk1b	UTSW	7	28184312	missense	probably damaging	1.00
R7700:Dyrk1b	UTSW	7	28184312	missense	probably damaging	1.00
R8177:Dyrk1b	UTSW	7	28183176	missense	possibly damaging	0.86
R8271:Dyrk1b	UTSW	7	28182655	missense	probably benign	0.02
R9241:Dyrk1b	UTSW	7	28186633	missense	probably benign	0.00
X0060:Dyrk1b	UTSW	7	28183150	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CATGCCTTGGAAGTCCAGTGAGTTG -3'
(R):5'- CGAAGTCCACGATCTTGATGGCAC -3'

Sequencing Primer
(F):5'- TCCAGTGAGTTGGTGTAGAAAC -3'
(R):5'- CTTGATGGCACTGCGCTTG -3'

Posted On

2013-05-23