Incidental Mutation 'R0280:Evi5l'
ID 37457
Institutional Source Beutler Lab
Gene Symbol Evi5l
Ensembl Gene ENSMUSG00000011832
Gene Name ecotropic viral integration site 5 like
Synonyms
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R0280 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 4166567-4211257 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4193133 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 339 (V339A)
Ref Sequence ENSEMBL: ENSMUSP00000134867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176072] [ENSMUST00000176149] [ENSMUST00000176764] [ENSMUST00000176825] [ENSMUST00000177053]
AlphaFold H3BKQ3
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148353
Predicted Effect probably damaging
Transcript: ENSMUST00000176072
AA Change: V339A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134867
Gene: ENSMUSG00000011832
AA Change: V339A

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 415 451 4.14e-7 PROSPERO
coiled coil region 455 478 N/A INTRINSIC
internal_repeat_1 513 549 4.14e-7 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176149
AA Change: V339A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135479
Gene: ENSMUSG00000011832
AA Change: V339A

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 463 509 1.56e-7 PROSPERO
coiled coil region 513 536 N/A INTRINSIC
internal_repeat_1 563 607 1.56e-7 PROSPERO
low complexity region 755 766 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176462
Predicted Effect probably benign
Transcript: ENSMUST00000176764
AA Change: V339A

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134857
Gene: ENSMUSG00000011832
AA Change: V339A

DomainStartEndE-ValueType
Blast:TBC 27 100 4e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
coiled coil region 363 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176825
AA Change: V339A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135700
Gene: ENSMUSG00000011832
AA Change: V339A

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 452 498 1.86e-7 PROSPERO
coiled coil region 502 525 N/A INTRINSIC
internal_repeat_1 552 596 1.86e-7 PROSPERO
low complexity region 744 755 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177053
AA Change: V339A

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135159
Gene: ENSMUSG00000011832
AA Change: V339A

DomainStartEndE-ValueType
Blast:TBC 27 100 3e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177309
Meta Mutation Damage Score 0.1093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Evi5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Evi5l APN 8 4193219 critical splice donor site probably null
IGL02143:Evi5l APN 8 4191293 missense probably damaging 0.99
IGL02322:Evi5l APN 8 4187236 splice site probably benign
IGL02528:Evi5l APN 8 4193172 missense probably benign 0.25
IGL02822:Evi5l APN 8 4187248 missense probably damaging 1.00
R1764:Evi5l UTSW 8 4203560 missense probably damaging 0.98
R2032:Evi5l UTSW 8 4210622 missense probably damaging 1.00
R2158:Evi5l UTSW 8 4193195 missense probably damaging 0.99
R2175:Evi5l UTSW 8 4187269 missense probably damaging 1.00
R2357:Evi5l UTSW 8 4193113 splice site probably benign
R3055:Evi5l UTSW 8 4191603 nonsense probably null
R3724:Evi5l UTSW 8 4178080 intron probably benign
R3956:Evi5l UTSW 8 4191358 missense possibly damaging 0.72
R4342:Evi5l UTSW 8 4183492 utr 5 prime probably benign
R4621:Evi5l UTSW 8 4202909 intron probably benign
R4622:Evi5l UTSW 8 4202909 intron probably benign
R4959:Evi5l UTSW 8 4205406 missense probably benign 0.00
R4973:Evi5l UTSW 8 4205406 missense probably benign 0.00
R5052:Evi5l UTSW 8 4206019 intron probably benign
R5097:Evi5l UTSW 8 4193317 missense probably damaging 0.97
R5344:Evi5l UTSW 8 4185990 missense possibly damaging 0.78
R5357:Evi5l UTSW 8 4203623 missense possibly damaging 0.63
R5376:Evi5l UTSW 8 4210770 missense probably damaging 0.99
R5382:Evi5l UTSW 8 4178653 intron probably benign
R5500:Evi5l UTSW 8 4191658 missense probably damaging 0.96
R5554:Evi5l UTSW 8 4206491 splice site probably benign
R5689:Evi5l UTSW 8 4205460 nonsense probably null
R5788:Evi5l UTSW 8 4206800 utr 3 prime probably benign
R6321:Evi5l UTSW 8 4203080 missense probably benign
R6520:Evi5l UTSW 8 4205906 missense possibly damaging 0.76
R6620:Evi5l UTSW 8 4206674 missense possibly damaging 0.84
R6707:Evi5l UTSW 8 4206322 missense probably benign
R7232:Evi5l UTSW 8 4205906 missense possibly damaging 0.71
R7692:Evi5l UTSW 8 4200886 missense probably damaging 1.00
R7985:Evi5l UTSW 8 4203536 missense probably benign 0.27
R8162:Evi5l UTSW 8 4191300 missense probably damaging 1.00
R8474:Evi5l UTSW 8 4210784 missense possibly damaging 0.94
R8512:Evi5l UTSW 8 4193121 missense probably benign 0.01
R8758:Evi5l UTSW 8 4205860 missense probably benign 0.13
R8970:Evi5l UTSW 8 4186154 splice site probably benign
R9138:Evi5l UTSW 8 4183582 missense probably benign 0.03
X0062:Evi5l UTSW 8 4191303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCATGGCACACAGTATCTCAC -3'
(R):5'- GGCACTCACTTTGATCTCGATCTGC -3'

Sequencing Primer
(F):5'- ggatgggactcaggtcagg -3'
(R):5'- TTCTCCAGCCTGTGAGGAC -3'
Posted On 2013-05-23