Incidental Mutation 'R4908:Zfyve26'
ID379227
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Namezinc finger, FYVE domain containing 26
SynonymsA630028O16Rik, LOC380767, 9330197E15Rik
MMRRC Submission 042510-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4908 (G1)
Quality Score165
Status Not validated
Chromosome12
Chromosomal Location79232346-79296304 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 79249695 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]
Predicted Effect probably null
Transcript: ENSMUST00000021547
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218377
Predicted Effect probably benign
Transcript: ENSMUST00000219912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220092
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,943 I79L probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acaa1a G A 9: 119,348,706 S218N probably benign Het
Acsm5 A T 7: 119,538,091 I377F probably damaging Het
Ahnak2 T C 12: 112,775,272 T789A probably benign Het
Ak9 A T 10: 41,420,682 T1475S unknown Het
AU040320 A T 4: 126,853,288 N1028Y probably damaging Het
Bahcc1 T A 11: 120,287,754 S2380T probably benign Het
Cadps A G 14: 12,536,386 Y525H probably damaging Het
Casp8ap2 A G 4: 32,639,905 T320A possibly damaging Het
Ccdc138 A G 10: 58,544,995 N483D possibly damaging Het
Ccdc39 G A 3: 33,839,093 probably null Het
Cd300c2 T C 11: 114,996,946 N210S probably damaging Het
Cd84 A G 1: 171,872,865 D183G probably damaging Het
Cep95 C T 11: 106,811,346 P390S probably damaging Het
Chd9 A T 8: 91,015,249 H1622L possibly damaging Het
Cilp C A 9: 65,278,020 Q466K probably benign Het
Cinp T A 12: 110,884,053 T5S probably damaging Het
Clec4a2 T C 6: 123,142,503 L238S probably damaging Het
Cntrob T C 11: 69,320,906 Y164C probably damaging Het
Col6a3 A G 1: 90,807,524 L1408P probably damaging Het
Cul3 G A 1: 80,280,915 S468L possibly damaging Het
Dnah11 T A 12: 118,126,883 D1081V probably benign Het
Dnah2 C A 11: 69,521,147 V263L probably benign Het
Efna3 C G 3: 89,315,498 R185P probably damaging Het
F5 A T 1: 164,211,820 I2000F probably damaging Het
Fancm G A 12: 65,094,871 G422E probably benign Het
Gcnt2 A T 13: 40,860,734 D127V probably damaging Het
Gm21798 G T 15: 64,817,769 probably benign Het
Gm340 T A 19: 41,584,162 V452D probably benign Het
Gramd1a A C 7: 31,138,867 S320R probably benign Het
Grn T C 11: 102,436,518 probably benign Het
Helq A T 5: 100,762,641 probably null Het
Herc2 A G 7: 56,177,912 I2914V probably benign Het
Hnrnph1 T C 11: 50,378,410 V27A probably damaging Het
Hs1bp3 G T 12: 8,324,007 G182C probably damaging Het
Idnk C T 13: 58,163,453 P78L probably benign Het
Il10ra T C 9: 45,255,621 D544G probably benign Het
Inpp5e T C 2: 26,400,906 D383G probably damaging Het
Jak1 A T 4: 101,179,714 V243D probably damaging Het
Kcnma1 A T 14: 23,309,152 S1036T probably damaging Het
Kif26a G A 12: 112,157,342 C127Y probably damaging Het
Kif2c T C 4: 117,166,411 E368G probably damaging Het
Lasp1 T A 11: 97,833,704 probably null Het
Lrrtm1 C G 6: 77,244,678 H373D probably benign Het
Matr3 T A 18: 35,572,701 D226E probably damaging Het
Mmp17 G A 5: 129,605,666 W456* probably null Het
Mpp4 T C 1: 59,125,589 E463G probably damaging Het
Myh6 A C 14: 54,956,962 F737V probably damaging Het
Nars2 T A 7: 97,023,741 D271E probably benign Het
Nav2 A G 7: 49,604,510 E2352G probably damaging Het
Nckap1 A G 2: 80,523,374 probably null Het
Nckap5 A T 1: 126,027,587 S477R probably damaging Het
Nek11 T G 9: 105,298,289 I319L probably benign Het
Neto2 A G 8: 85,669,764 I84T probably damaging Het
Nlrp9a A T 7: 26,550,944 I45F probably damaging Het
Numa1 G A 7: 102,012,805 R548H probably damaging Het
Olfr1154 A T 2: 87,903,189 N162K probably damaging Het
Olfr1186 T A 2: 88,525,910 I109N probably damaging Het
Olfr1258 A T 2: 89,930,579 M257L probably benign Het
Olfr1280 T A 2: 111,316,229 F250Y probably benign Het
Olfr292 A C 7: 86,695,187 I244L probably benign Het
Olfr694 A T 7: 106,689,533 L66H probably damaging Het
Olfr713 A C 7: 107,036,157 M1L probably benign Het
Olfr843 A G 9: 19,248,853 V182A probably benign Het
Pcdhb16 T A 18: 37,479,841 probably null Het
Pdcd10 T C 3: 75,541,246 T4A probably damaging Het
Pgc A T 17: 47,728,894 Y71F probably damaging Het
Phlpp1 G A 1: 106,389,751 G1234E probably damaging Het
Prr27 T C 5: 87,843,029 F167L probably benign Het
Prrc2b T A 2: 32,226,318 S1421T possibly damaging Het
Pxmp2 A G 5: 110,283,652 V75A probably benign Het
Pygl A T 12: 70,197,033 M545K probably null Het
Ranbp9 A G 13: 43,421,257 Y412H possibly damaging Het
Rcc1 A G 4: 132,337,753 V140A probably damaging Het
Reln A G 5: 21,979,720 V1599A probably benign Het
Rhebl1 A T 15: 98,879,022 D122E probably damaging Het
Rock2 C T 12: 16,959,491 L676F probably benign Het
Scn9a A T 2: 66,526,743 D1062E probably benign Het
Sec63 T C 10: 42,805,190 I390T probably damaging Het
Slc10a6 T C 5: 103,606,627 E346G probably benign Het
Slc12a3 G A 8: 94,348,588 V737M possibly damaging Het
Slc12a8 T C 16: 33,606,259 probably null Het
Slc25a38 T A 9: 120,120,288 I102N probably damaging Het
Spg7 T A 8: 123,080,655 V390E probably damaging Het
Tbc1d20 T C 2: 152,302,308 V75A probably benign Het
Tesk1 T A 4: 43,445,555 C243* probably null Het
Ttk T A 9: 83,843,686 N220K possibly damaging Het
Ttll5 A G 12: 85,919,174 E651G probably benign Het
Tubd1 T C 11: 86,567,053 Y426H probably damaging Het
Uba6 T C 5: 86,140,434 silent Het
Ube2ql1 G A 13: 69,704,170 R263W probably damaging Het
Vmn2r117 C T 17: 23,459,838 G804D probably damaging Het
Vmn2r25 C T 6: 123,828,447 E484K probably benign Het
Vmn2r4 T A 3: 64,389,055 I770F possibly damaging Het
Vmn2r82 G A 10: 79,378,755 V191M probably benign Het
Zbtb45 C T 7: 13,008,110 V74M probably damaging Het
Zfp366 T C 13: 99,234,101 V443A possibly damaging Het
Zfyve1 A T 12: 83,551,571 C628S probably damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79249460 unclassified probably benign
IGL00940:Zfyve26 APN 12 79280900 missense probably benign
IGL01148:Zfyve26 APN 12 79260870 missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79252183 splice site probably null
IGL01472:Zfyve26 APN 12 79276343 missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79244373 missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79287851 missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79261574 splice site probably null
IGL01689:Zfyve26 APN 12 79284053 missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79287444 missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79244400 missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79276395 missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79268847 missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79280080 missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79239020 missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79263870 missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79261791 missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79295564 missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79284072 nonsense probably null
IGL02799:Zfyve26 UTSW 12 79273310 missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79276281 missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79244484 missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79246222 missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79268728 missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79265802 splice site probably benign
R0738:Zfyve26 UTSW 12 79295534 missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79273598 missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79272127 missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79263949 missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79274920 missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79282817 missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79252163 missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79252151 missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79287761 missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79238944 missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79278463 missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79269049 missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79286258 missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79264351 missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79239970 nonsense probably null
R1982:Zfyve26 UTSW 12 79255243 missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79284032 splice site probably null
R2071:Zfyve26 UTSW 12 79287446 missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79246052 missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79246087 missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79275040 missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79284116 missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79282799 splice site probably null
R3084:Zfyve26 UTSW 12 79265683 splice site probably benign
R3086:Zfyve26 UTSW 12 79265683 splice site probably benign
R4626:Zfyve26 UTSW 12 79269070 missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79244396 missense probably benign 0.16
R4926:Zfyve26 UTSW 12 79275011 missense probably benign
R4990:Zfyve26 UTSW 12 79287833 missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79280385 nonsense probably null
R5029:Zfyve26 UTSW 12 79286323 missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79255361 missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79280058 nonsense probably null
R5252:Zfyve26 UTSW 12 79268982 missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79270850 missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79246521 missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79239924 missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79273373 missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79264357 missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79287737 missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79266537 missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79293854 missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79268727 missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79249599 missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79282984 missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79240002 missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79238335 missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79266449 missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79284152 missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79279114 missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79280405 missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79268408 missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79246171 missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79278372 splice site probably null
R7299:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79251168 missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79240054 missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79287807 missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79268676 missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79290957 missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79268635 missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79280355 critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79255324 missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79268557 missense possibly damaging 0.79
R8190:Zfyve26 UTSW 12 79280836 missense probably benign 0.00
R8207:Zfyve26 UTSW 12 79260831 missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79255263 missense probably damaging 1.00
RF010:Zfyve26 UTSW 12 79255338 missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79239005 missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79268533 missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79287375 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGACGAACATCATCTTGGCAC -3'
(R):5'- TGTGTGACAAAACCTAGCAGC -3'

Sequencing Primer
(F):5'- CATCATCTTGGCACTGAAGAGTAGC -3'
(R):5'- GTGACAAAACCTAGCAGCCAGAG -3'
Posted On2016-04-15