Incidental Mutation 'R4980:Kif13a'
ID384765
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission 042575-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.459) question?
Stock #R4980 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46752746 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 574 (S574P)
Ref Sequence ENSEMBL: ENSMUSP00000153657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881]
Predicted Effect probably benign
Transcript: ENSMUST00000056978
AA Change: S1522P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: S1522P

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223881
AA Change: S574P

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000225836
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,426 C189S probably damaging Het
4932438A13Rik T C 3: 36,943,312 S1173P probably damaging Het
9030624J02Rik T A 7: 118,807,009 D605E probably damaging Het
Abcd3 A T 3: 121,769,268 probably null Het
Adar T C 3: 89,730,814 S2P probably benign Het
Amhr2 T A 15: 102,454,330 S511T probably benign Het
Atg16l1 T C 1: 87,766,831 S77P possibly damaging Het
C530008M17Rik A T 5: 76,857,574 D594V unknown Het
Cacna1i T C 15: 80,348,449 F218L probably damaging Het
Cd5l A T 3: 87,367,601 H149L probably benign Het
Cdc14a T A 3: 116,392,857 R92* probably null Het
Col19a1 T C 1: 24,526,483 T256A unknown Het
Col22a1 C T 15: 71,801,943 A975T unknown Het
Cyp20a1 T C 1: 60,363,214 W153R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dpyd T C 3: 118,917,118 S392P probably damaging Het
Dst A T 1: 34,256,288 L957F probably damaging Het
Emilin2 G T 17: 71,253,071 D970E possibly damaging Het
Fam208a T A 14: 27,461,425 L614I probably benign Het
Fbn2 T C 18: 58,010,631 E2784G probably benign Het
Fbxw10 T C 11: 62,847,757 I159T possibly damaging Het
Fgfr2 T C 7: 130,201,080 Y192C probably damaging Het
Gm7298 A G 6: 121,759,239 probably null Het
Igf2r C T 17: 12,703,360 probably null Het
Ints4 T C 7: 97,501,850 probably null Het
Kcnf1 A G 12: 17,175,011 F403S possibly damaging Het
Kif11 C T 19: 37,387,371 Q211* probably null Het
Kifc3 T A 8: 95,126,549 T60S probably benign Het
Krt82 T C 15: 101,545,099 D284G possibly damaging Het
Lancl1 T C 1: 67,004,809 Y344C probably benign Het
Ltbp3 A T 19: 5,753,927 probably null Het
Map3k4 A G 17: 12,272,071 F158L probably damaging Het
Mast2 A G 4: 116,317,751 Y469H probably damaging Het
Mcf2l T G 8: 12,984,883 F97C probably damaging Het
Mpeg1 T C 19: 12,461,540 S121P probably damaging Het
Mycbp2 A T 14: 103,260,385 probably null Het
Myt1l A T 12: 29,827,039 T230S unknown Het
Naa15 T C 3: 51,458,752 probably null Het
Nans G A 4: 46,492,764 R64Q probably benign Het
Nbea C T 3: 55,647,351 probably null Het
Nbea T C 3: 55,953,045 E1870G probably benign Het
Ncapd3 T C 9: 27,063,295 S688P probably damaging Het
Nedd4l G T 18: 65,080,060 E96* probably null Het
Olfr1444 A T 19: 12,862,020 M82L probably benign Het
Olfr683 T A 7: 105,144,224 Y23F probably benign Het
Pdxk A G 10: 78,451,484 L81P probably damaging Het
Plec T A 15: 76,193,295 R269* probably null Het
Plec T C 15: 76,205,865 I92V probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppp2r2c A T 5: 36,952,388 M364L probably benign Het
Prag1 A C 8: 36,139,586 H827P probably damaging Het
Ptprg A G 14: 12,154,421 N714S probably benign Het
Rbp2 G A 9: 98,498,841 V67I probably benign Het
Rictor T A 15: 6,781,660 Y835N probably damaging Het
Ripply2 A G 9: 87,019,694 Q91R probably damaging Het
Sap130 C A 18: 31,649,646 H203Q possibly damaging Het
Sema4d T C 13: 51,711,234 Y358C probably damaging Het
Serbp1 G A 6: 67,277,888 D294N probably benign Het
Slc16a10 A G 10: 40,080,805 W113R probably damaging Het
Slc6a6 A G 6: 91,726,060 Y138C probably damaging Het
Spag11a T C 8: 19,157,946 M1T probably null Het
Spata20 T C 11: 94,484,609 M120V probably damaging Het
Stk32a A C 18: 43,314,048 K357Q probably benign Het
Trmo A T 4: 46,389,364 C10* probably null Het
Tsc22d1 T G 14: 76,418,256 V643G probably benign Het
Vangl2 A T 1: 172,009,565 L226I probably damaging Het
Wnt3a A T 11: 59,249,800 C297S probably damaging Het
Wwc1 T C 11: 35,888,103 K301E possibly damaging Het
Zfhx4 C T 3: 5,398,979 T1399I possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
R7693:Kif13a UTSW 13 46750613 missense probably benign 0.01
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACATCCGGTGCAAGTGATG -3'
(R):5'- CAGACTGTGGCTCTAAGGAG -3'

Sequencing Primer
(F):5'- ACCTCCTTTGTCGAGACGG -3'
(R):5'- GCTAATGGCTGGCTCTGGC -3'
Posted On2016-05-10