Mutagenetix > Incidental Mutation

Incidental Mutation 'R0046:Rgs12'

43697

Institutional Source

Beutler Lab

Gene Symbol

Rgs12

Ensembl Gene

ENSMUSG00000029101

Gene Name

regulator of G-protein signaling 12

Synonyms

1200016K18Rik, 4632412M04Rik

MMRRC Submission

038340-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.325) question?

Stock #

R0046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34949445-35039644 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34965320 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 149 (I149N)

Ref Sequence

ENSEMBL: ENSMUSP00000084970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684]

AlphaFold

Q8CGE9

Predicted Effect

probably damaging
Transcript: ENSMUST00000030984
AA Change: I149N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: I149N

Domain	Start	End	E-Value	Type
PDZ	29	98	5.25e-18	SMART
PTB	224	373	5.05e-28	SMART
low complexity region	443	456	N/A	INTRINSIC
low complexity region	643	661	N/A	INTRINSIC
low complexity region	685	697	N/A	INTRINSIC
RGS	715	832	2.84e-41	SMART
low complexity region	849	865	N/A	INTRINSIC
low complexity region	868	880	N/A	INTRINSIC
low complexity region	911	928	N/A	INTRINSIC
RBD	962	1032	3.12e-28	SMART
RBD	1034	1104	2.44e-21	SMART
GoLoco	1187	1209	9.74e-9	SMART
low complexity region	1259	1280	N/A	INTRINSIC
low complexity region	1292	1308	N/A	INTRINSIC
low complexity region	1359	1378	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087684
AA Change: I149N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: I149N

Domain	Start	End	E-Value	Type
PDZ	29	98	5.25e-18	SMART
PTB	224	373	5.05e-28	SMART
low complexity region	443	456	N/A	INTRINSIC
low complexity region	643	661	N/A	INTRINSIC
low complexity region	685	697	N/A	INTRINSIC
RGS	715	832	2.84e-41	SMART
Pfam:RGS12_us1	836	953	4.3e-61	PFAM
RBD	962	1032	3.12e-28	SMART
RBD	1034	1104	2.44e-21	SMART
Pfam:RGS12_us2	1106	1180	2.4e-37	PFAM
GoLoco	1187	1209	9.74e-9	SMART
Pfam:RGS12_usC	1238	1379	9.2e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128161

Meta Mutation Damage Score

0.5816

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	T	4: 56,743,877	K135*	probably null	Het
Adamts16	A	G	13: 70,763,460	S871P	probably benign	Het
Adcy10	A	T	1: 165,539,834	I558F	probably damaging	Het
Adsl	T	G	15: 80,962,788		probably null	Het
Aldob	T	C	4: 49,543,842	I47V	possibly damaging	Het
Alkbh8	A	G	9: 3,343,247	E46G	probably damaging	Het
Ankrd33b	G	A	15: 31,367,337	P19L	probably damaging	Het
Apoa5	T	C	9: 46,269,998	L124S	probably damaging	Het
Atp1a4	A	T	1: 172,240,097	L533Q	probably benign	Het
Atp7b	T	C	8: 22,059,995	T9A	probably benign	Het
Auh	G	A	13: 52,929,385		probably benign	Het
B3gnt3	T	C	8: 71,692,923	Y267C	probably damaging	Het
BC051142	T	C	17: 34,460,121		probably null	Het
Card11	T	C	5: 140,908,524	T117A	possibly damaging	Het
Ccdc39	A	G	3: 33,844,152	F15L	possibly damaging	Het
Chtf18	C	T	17: 25,723,460	R468Q	probably benign	Het
Cntnap5c	T	G	17: 58,359,300	D1108E	probably benign	Het
Col14a1	G	A	15: 55,408,963		probably benign	Het
Col6a6	C	T	9: 105,748,848		probably benign	Het
Col9a3	G	A	2: 180,609,487	A317T	possibly damaging	Het
Cpt1c	A	T	7: 44,959,832		probably benign	Het
Cpt2	A	G	4: 107,904,362		probably null	Het
Crebrf	T	A	17: 26,763,334	L565M	probably damaging	Het
Cyp2d41-ps	T	A	15: 82,782,035		noncoding transcript	Het
Dhx9	C	T	1: 153,472,707	V291M	probably benign	Het
Dmxl1	T	A	18: 49,878,082	V1102E	probably benign	Het
Dnah7a	A	T	1: 53,456,874		probably null	Het
Dock4	G	A	12: 40,737,360		probably benign	Het
Dpp3	G	T	19: 4,914,643	N545K	probably damaging	Het
Elmo2	T	A	2: 165,298,726	N275I	probably damaging	Het
Farp1	A	G	14: 121,255,513	K509R	probably benign	Het
Fat3	T	C	9: 15,965,979	Y3446C	possibly damaging	Het
Fgd2	T	A	17: 29,374,990		probably benign	Het
Flg	T	A	3: 93,277,721		probably benign	Het
Gas2l2	A	T	11: 83,421,910	W859R	probably damaging	Het
Gatm	T	C	2: 122,600,744	D254G	probably damaging	Het
Gjd4	T	A	18: 9,280,998	I27F	probably damaging	Het
Gsdmc2	C	A	15: 63,827,755		probably benign	Het
Haus5	C	T	7: 30,654,180	V591I	probably benign	Het
Kcnab3	G	A	11: 69,330,227		probably null	Het
Khdrbs2	A	G	1: 32,619,202	D281G	possibly damaging	Het
Krt86	A	T	15: 101,477,402	M393L	probably benign	Het
Limk1	T	C	5: 134,672,761	Y96C	probably damaging	Het
Lrp2bp	T	A	8: 46,013,155	Y100*	probably null	Het
Mamstr	T	G	7: 45,641,770		probably benign	Het
Man1a	A	G	10: 53,919,187	Y657H	probably damaging	Het
Marf1	G	A	16: 14,111,727	P1672S	possibly damaging	Het
Mboat7	T	C	7: 3,683,818	Y341C	probably damaging	Het
Nhsl1	A	T	10: 18,525,669	N881I	probably damaging	Het
Nox3	T	C	17: 3,682,961	Y225C	probably benign	Het
Nrp1	C	T	8: 128,500,608		probably benign	Het
Olfr1080	A	G	2: 86,553,632	F164S	probably damaging	Het
Olfr1214	C	T	2: 88,987,349	M284I	probably benign	Het
Olfr1260	C	T	2: 89,978,507	T243I	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr742	T	A	14: 50,516,139	*312K	probably null	Het
Pcdhb13	A	T	18: 37,444,257	M563L	probably benign	Het
Pclo	C	T	5: 14,540,479	T931M	unknown	Het
Peli2	C	T	14: 48,121,202	P16S	possibly damaging	Het
Pfas	G	T	11: 68,990,467	R1025S	probably benign	Het
Pik3c2a	A	T	7: 116,354,072	I1196N	probably damaging	Het
Pmfbp1	A	T	8: 109,535,985		probably benign	Het
Prg4	T	C	1: 150,456,086	T279A	possibly damaging	Het
Psma1	A	T	7: 114,267,205		probably benign	Het
Rab11fip1	A	G	8: 27,153,121	L550P	probably damaging	Het
Rmnd5a	T	C	6: 71,399,231	H195R	probably damaging	Het
Rnf17	T	C	14: 56,471,373	L750P	probably damaging	Het
Rtcb	T	C	10: 85,957,656	N18D	probably benign	Het
Seh1l	T	C	18: 67,792,016		probably null	Het
Sis	T	G	3: 72,932,094	N813T	probably benign	Het
Sptbn2	T	C	19: 4,745,377		probably benign	Het
Stag3	C	T	5: 138,283,023		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Taok3	C	T	5: 117,272,229	Q829*	probably null	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ttn	A	G	2: 76,951,542		probably benign	Het
Unc79	A	G	12: 103,125,681	E1756G	probably damaging	Het
Usp35	A	T	7: 97,313,597		probably null	Het
Vmn2r111	A	G	17: 22,548,009	F836L	probably benign	Het
Vmn2r77	A	G	7: 86,801,938	D344G	possibly damaging	Het
Zbtb40	A	G	4: 136,987,278	C1067R	probably damaging	Het

Other mutations in Rgs12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01443:Rgs12	APN	5	34975219	missense	probably benign	0.25
IGL02296:Rgs12	APN	5	34966120	missense	probably damaging	0.96
IGL02337:Rgs12	APN	5	35020353	missense	probably damaging	1.00
IGL02483:Rgs12	APN	5	35030517	missense	probably damaging	1.00
IGL02869:Rgs12	APN	5	35025883	missense	probably damaging	0.97
IGL02989:Rgs12	APN	5	34965119	missense	probably damaging	1.00
R0015:Rgs12	UTSW	5	35022776	unclassified	probably benign
R0015:Rgs12	UTSW	5	35022776	unclassified	probably benign
R0046:Rgs12	UTSW	5	34965320	missense	probably damaging	1.00
R0106:Rgs12	UTSW	5	34966664	missense	probably benign	0.03
R0106:Rgs12	UTSW	5	34966664	missense	probably benign	0.03
R0233:Rgs12	UTSW	5	35030498	missense	probably damaging	1.00
R0233:Rgs12	UTSW	5	35030498	missense	probably damaging	1.00
R0245:Rgs12	UTSW	5	35030080	missense	probably benign	0.01
R0611:Rgs12	UTSW	5	35019460	missense	probably damaging	1.00
R0704:Rgs12	UTSW	5	35023122	missense	possibly damaging	0.95
R0723:Rgs12	UTSW	5	35024366	unclassified	probably benign
R1174:Rgs12	UTSW	5	34966465	missense	probably benign	0.00
R1538:Rgs12	UTSW	5	35021167	missense	probably damaging	0.98
R1556:Rgs12	UTSW	5	35039282	missense	possibly damaging	0.67
R1774:Rgs12	UTSW	5	34966403	missense	probably benign	0.34
R1791:Rgs12	UTSW	5	34966112	missense	possibly damaging	0.86
R1866:Rgs12	UTSW	5	34965674	missense	probably damaging	1.00
R1872:Rgs12	UTSW	5	34965821	missense	probably damaging	1.00
R1923:Rgs12	UTSW	5	35032269	missense	probably damaging	1.00
R2012:Rgs12	UTSW	5	35030528	missense	probably benign	0.00
R2107:Rgs12	UTSW	5	34966735	missense	possibly damaging	0.68
R3730:Rgs12	UTSW	5	35032251	missense	probably damaging	1.00
R3731:Rgs12	UTSW	5	35032251	missense	probably damaging	1.00
R3808:Rgs12	UTSW	5	35032354	missense	probably damaging	1.00
R3826:Rgs12	UTSW	5	34966015	missense	possibly damaging	0.94
R3827:Rgs12	UTSW	5	34966015	missense	possibly damaging	0.94
R3829:Rgs12	UTSW	5	34966015	missense	possibly damaging	0.94
R3830:Rgs12	UTSW	5	34966015	missense	possibly damaging	0.94
R4392:Rgs12	UTSW	5	35032311	missense	probably damaging	1.00
R4617:Rgs12	UTSW	5	35020356	missense	probably damaging	1.00
R5132:Rgs12	UTSW	5	34989812	intron	probably benign
R5213:Rgs12	UTSW	5	34965320	missense	probably damaging	1.00
R5296:Rgs12	UTSW	5	35021104	unclassified	probably benign
R5480:Rgs12	UTSW	5	34966111	missense	probably benign	0.09
R5510:Rgs12	UTSW	5	34966039	missense	probably damaging	1.00
R5708:Rgs12	UTSW	5	34966352	missense	probably benign	0.41
R5987:Rgs12	UTSW	5	35020345	missense	probably damaging	1.00
R6053:Rgs12	UTSW	5	34965952	missense	probably benign	0.01
R6113:Rgs12	UTSW	5	35020323	missense	probably damaging	0.99
R6401:Rgs12	UTSW	5	35020332	missense	probably damaging	1.00
R6736:Rgs12	UTSW	5	35023092	missense	probably damaging	1.00
R6807:Rgs12	UTSW	5	35023171	missense	probably null	0.27
R6857:Rgs12	UTSW	5	35030022	nonsense	probably null
R7082:Rgs12	UTSW	5	34966706	missense	probably benign	0.00
R7250:Rgs12	UTSW	5	34965497	missense	probably damaging	1.00
R7276:Rgs12	UTSW	5	35026371	missense	probably benign	0.06
R7444:Rgs12	UTSW	5	35025943	missense	possibly damaging	0.65
R7632:Rgs12	UTSW	5	34965590	missense	probably damaging	1.00
R8049:Rgs12	UTSW	5	35026030	missense	possibly damaging	0.89
R8089:Rgs12	UTSW	5	35020348	missense	probably damaging	1.00
R8241:Rgs12	UTSW	5	34965773	missense	probably damaging	1.00
R8797:Rgs12	UTSW	5	35029571	missense
R8927:Rgs12	UTSW	5	34966289	missense	possibly damaging	0.93
R8928:Rgs12	UTSW	5	34966289	missense	possibly damaging	0.93
R9073:Rgs12	UTSW	5	35020409	unclassified	probably benign
R9211:Rgs12	UTSW	5	34965821	missense	probably damaging	0.98
R9485:Rgs12	UTSW	5	35032270	missense	probably damaging	0.99
R9550:Rgs12	UTSW	5	35039321	missense	probably damaging	0.99
Z1176:Rgs12	UTSW	5	34965769	missense	probably damaging	1.00
Z1177:Rgs12	UTSW	5	34964854	start gained	probably benign
Z1177:Rgs12	UTSW	5	35026352	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GGGGACCAGATACTTGCCATCAAC -3'
(R):5'- CAAAGTCATCGTGACTGTCCAGACC -3'

Sequencing Primer
(F):5'- CCTCCCATGAAGATGTGGTG -3'
(R):5'- GACTGTCCAGACCCACAGTG -3'

Posted On

2013-05-29