Incidental Mutation 'R5649:Olfm3'
ID441309
Institutional Source Beutler Lab
Gene Symbol Olfm3
Ensembl Gene ENSMUSG00000027965
Gene Nameolfactomedin 3
Synonymsoptimedin, B230206G02Rik
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location114904078-115125722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115096924 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 76 (R76G)
Ref Sequence ENSEMBL: ENSMUSP00000121097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051309] [ENSMUST00000081752] [ENSMUST00000149158]
Predicted Effect probably damaging
Transcript: ENSMUST00000051309
AA Change: R109G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060985
Gene: ENSMUSG00000027965
AA Change: R109G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 46 145 3.9e-52 PFAM
Blast:OLF 162 207 3e-8 BLAST
OLF 220 470 4.33e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081752
AA Change: R89G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080448
Gene: ENSMUSG00000027965
AA Change: R89G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Noelin-1 25 125 7.6e-54 PFAM
Blast:OLF 142 187 3e-8 BLAST
OLF 200 450 4.33e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149158
AA Change: R76G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121097
Gene: ENSMUSG00000027965
AA Change: R76G

DomainStartEndE-ValueType
Pfam:Noelin-1 12 112 2.5e-51 PFAM
Blast:OLF 129 174 1e-8 BLAST
Blast:OLF 187 210 1e-7 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Olfm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Olfm3 APN 3 115122633 missense probably damaging 1.00
IGL01686:Olfm3 APN 3 115122848 missense probably benign 0.00
IGL01732:Olfm3 APN 3 115097000 missense possibly damaging 0.82
IGL02539:Olfm3 APN 3 115101930 missense possibly damaging 0.93
IGL02580:Olfm3 APN 3 115122508 missense probably damaging 1.00
IGL02999:Olfm3 APN 3 115122748 missense probably damaging 1.00
IGL03142:Olfm3 APN 3 115097030 missense probably damaging 0.97
IGL03239:Olfm3 APN 3 115122594 missense probably damaging 0.99
R0361:Olfm3 UTSW 3 115120973 missense probably damaging 1.00
R0373:Olfm3 UTSW 3 115122805 missense probably damaging 0.99
R0505:Olfm3 UTSW 3 115122681 missense possibly damaging 0.46
R0689:Olfm3 UTSW 3 115122545 missense probably benign 0.28
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0974:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R1253:Olfm3 UTSW 3 115122769 missense probably damaging 0.98
R1293:Olfm3 UTSW 3 115101930 missense possibly damaging 0.93
R1952:Olfm3 UTSW 3 115101940 missense probably null 1.00
R2255:Olfm3 UTSW 3 115122193 splice site probably null
R2334:Olfm3 UTSW 3 115101959 nonsense probably null
R2510:Olfm3 UTSW 3 115122310 missense probably damaging 1.00
R4222:Olfm3 UTSW 3 115090171 nonsense probably null
R4716:Olfm3 UTSW 3 115081106 missense probably benign 0.00
R4912:Olfm3 UTSW 3 115101940 missense probably damaging 1.00
R5084:Olfm3 UTSW 3 114904553 critical splice donor site probably null
R5681:Olfm3 UTSW 3 115122275 missense probably benign 0.28
R5861:Olfm3 UTSW 3 115122403 missense probably damaging 1.00
R5924:Olfm3 UTSW 3 115122538 missense probably benign 0.44
R5929:Olfm3 UTSW 3 115101880 missense probably damaging 0.97
R5958:Olfm3 UTSW 3 115122306 missense probably damaging 0.99
R6166:Olfm3 UTSW 3 115122425 missense probably damaging 1.00
R6299:Olfm3 UTSW 3 115120983 missense probably damaging 1.00
R6804:Olfm3 UTSW 3 115122679 missense probably benign 0.10
R7032:Olfm3 UTSW 3 115090156 missense probably damaging 1.00
R7565:Olfm3 UTSW 3 115122744 missense probably damaging 0.98
R7600:Olfm3 UTSW 3 115096940 missense possibly damaging 0.65
R7976:Olfm3 UTSW 3 115081145 missense probably benign 0.00
R8070:Olfm3 UTSW 3 115101955 missense probably damaging 0.96
R8334:Olfm3 UTSW 3 115122557 missense probably damaging 0.96
R8527:Olfm3 UTSW 3 115122547 missense probably benign 0.10
R8542:Olfm3 UTSW 3 115122547 missense probably benign 0.10
R8835:Olfm3 UTSW 3 115122412 missense probably damaging 1.00
Z1088:Olfm3 UTSW 3 114904668 start gained probably benign
Z1177:Olfm3 UTSW 3 115081101 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGTATTATCACCTTTTGAAGCC -3'
(R):5'- ATTTCCAACTTAGTGACTTGCTACC -3'

Sequencing Primer
(F):5'- GGAATCTTGTTGAAAATGAGACAAC -3'
(R):5'- GTGACTTGCTACCTGTATACAATGC -3'
Posted On2016-11-08