Mutagenetix > Incidental Mutation

Incidental Mutation 'R5649:Rgsl1'

441300

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

043170-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5649 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 153825893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 272 (P272S)

Ref Sequence

ENSEMBL: ENSMUSP00000135642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124558
AA Change: P272S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: P272S

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134030

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185164
AA Change: P307S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: P307S

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,972	E33G	probably benign	Het
Abca12	T	C	1: 71,291,342	T1385A	probably damaging	Het
Apc2	T	A	10: 80,314,138	D1646E	probably damaging	Het
Aspm	G	A	1: 139,479,669	R2098H	probably benign	Het
Atl3	C	A	19: 7,532,227	T435N	possibly damaging	Het
Cdh22	G	T	2: 165,116,280	T589K	probably damaging	Het
Cnot3	T	C	7: 3,658,083	L561S	probably benign	Het
Col5a1	A	G	2: 27,951,456	D363G	unknown	Het
Cyp24a1	T	C	2: 170,496,309	D105G	possibly damaging	Het
Dennd4a	C	A	9: 64,851,209		probably null	Het
Dnah8	A	G	17: 30,800,587	K3878R	probably benign	Het
Dock4	T	C	12: 40,844,540	S1900P	probably benign	Het
Fancg	A	G	4: 43,008,736	L167P	probably damaging	Het
Ighd2-8	A	G	12: 113,450,867	S1P	possibly damaging	Het
Kif28	A	G	1: 179,697,771		probably null	Het
Mrpl55	T	A	11: 59,204,571	C20*	probably null	Het
Myo5a	A	G	9: 75,171,719	K920E	possibly damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Olfm3	A	G	3: 115,096,924	R76G	probably damaging	Het
Olfr304	T	C	7: 86,386,313	M116V	probably damaging	Het
Olfr705	T	C	7: 106,714,166	R172G	possibly damaging	Het
Pcdha12	A	T	18: 37,022,415	D729V	probably benign	Het
Phf11c	T	C	14: 59,385,532		probably null	Het
Phf20	T	A	2: 156,251,768		probably null	Het
Plbd1	T	A	6: 136,616,989	Y376F	probably benign	Het
Poglut1	A	G	16: 38,531,811	V257A	probably damaging	Het
Reln	A	G	5: 21,901,625	I3249T	probably benign	Het
Slc15a2	A	T	16: 36,772,110	Y197*	probably null	Het
Slc45a2	C	T	15: 11,012,607	T232I	probably benign	Het
Ssc5d	T	A	7: 4,926,518		probably null	Het
Thbs2	T	C	17: 14,689,953	Y128C	probably damaging	Het
Them4	A	T	3: 94,331,544	L219F	possibly damaging	Het
Tmem30b	G	T	12: 73,546,166	N58K	probably benign	Het
Ttc29	G	A	8: 78,246,313	E131K	possibly damaging	Het
Vmn1r29	C	G	6: 58,307,691	S132C	probably benign	Het
Vmn1r53	G	A	6: 90,223,760	A194V	probably benign	Het
Wdr86	A	T	5: 24,718,087	H202Q	probably benign	Het
Xirp2	A	G	2: 67,516,895	D3160G	probably benign	Het
Xkr5	T	C	8: 18,933,966	D520G	probably benign	Het
Zfp607b	T	G	7: 27,703,981	C621G	probably damaging	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGAACGCTGTCTCAAGGAAGC -3'
(R):5'- GAAGCATGCCATGGTCTGATG -3'

Sequencing Primer
(F):5'- TGTCTCAAGGAAGCCCTCC -3'
(R):5'- TCTGATGCAGGAATATGAGACTCGC -3'

Posted On

2016-11-08