Incidental Mutation 'R5691:Abcb5'
ID443703
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 043324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5691 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118927235 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 509 (M509K)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably damaging
Transcript: ENSMUST00000035515
AA Change: M509K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: M509K

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410022M11Rik A G 14: 56,812,373 probably benign Het
Ap4m1 A G 5: 138,172,391 Y34C probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Bcl10 C T 3: 145,933,149 T182I probably benign Het
Cdc123 T A 2: 5,823,175 N87I probably benign Het
Cfap46 T C 7: 139,606,700 E2431G possibly damaging Het
Dcc T C 18: 71,575,083 T521A probably damaging Het
Defb46 T A 8: 19,242,133 I55K probably benign Het
Dlgap4 A G 2: 156,704,470 T353A probably benign Het
Eqtn C A 4: 94,923,728 probably null Het
Ermn A T 2: 58,047,764 M279K probably damaging Het
Fan1 C A 7: 64,354,370 probably null Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Gm13084 A T 4: 143,812,009 W131R probably benign Het
Gm6614 A T 6: 141,994,855 Y93* probably null Het
Gm9745 A T 13: 8,942,657 Y91* probably null Het
Hectd4 A G 5: 121,348,815 D3291G possibly damaging Het
Hid1 A G 11: 115,348,819 W762R probably damaging Het
Ifi207 A G 1: 173,732,426 I160T unknown Het
Inpp4b T A 8: 81,890,694 probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Jph1 T G 1: 17,004,363 Q477P probably benign Het
Kdm4c A T 4: 74,334,728 I511L probably benign Het
Lrp2 T C 2: 69,502,553 D1540G probably damaging Het
Lrrc69 T A 4: 14,769,648 I168F probably damaging Het
Mgat4e A T 1: 134,540,991 probably benign Het
Mroh7 C A 4: 106,702,618 G704V probably damaging Het
Nadsyn1 C T 7: 143,812,579 probably null Het
Ncoa2 A T 1: 13,180,550 C303S probably damaging Het
Nova1 T C 12: 46,816,955 T71A unknown Het
Nrcam T C 12: 44,564,256 Y554H probably damaging Het
Nubpl G A 12: 52,105,276 probably benign Het
Oasl2 C A 5: 114,899,767 T75K possibly damaging Het
Olfr1099 A T 2: 86,959,272 F62Y probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Parp14 A G 16: 35,863,539 V139A probably benign Het
Pgam5 G A 5: 110,267,093 P85S probably damaging Het
Phpt1 T C 2: 25,573,695 Y96C probably damaging Het
Plekhm2 A C 4: 141,628,289 S867A possibly damaging Het
Prss21 A G 17: 23,868,785 probably null Het
Rabgap1l A T 1: 160,735,684 Y108N probably damaging Het
Riox1 C T 12: 83,951,692 T334I possibly damaging Het
Rps3a2 G T 14: 88,123,047 noncoding transcript Het
Selenot C T 3: 58,586,026 A108V probably benign Het
Setd3 A T 12: 108,160,285 M98K probably benign Het
Slc22a27 T C 19: 7,926,670 H34R possibly damaging Het
Sp3 A G 2: 72,971,459 L70S probably damaging Het
Syne2 TCCAGGTAGGGCACACC TCC 12: 76,027,856 probably null Het
Tcl1b4 C A 12: 105,202,547 D23E possibly damaging Het
Tespa1 T A 10: 130,354,769 probably null Het
Tmc7 T C 7: 118,541,893 I672V probably benign Het
Trps1 T A 15: 50,827,304 Q14L probably benign Het
Vmn2r73 A G 7: 85,858,091 V671A probably damaging Het
Zfp106 G A 2: 120,524,471 S1273F probably damaging Het
Zfp90 C A 8: 106,425,078 Y474* probably null Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CGCAATTGGCCTTTTACTGACG -3'
(R):5'- TTTGGTATGGCAGATCACCG -3'

Sequencing Primer
(F):5'- AATTGGCCTTTTACTGACGTCTTC -3'
(R):5'- TCACCGTAGATGAGAATGACATCCG -3'
Posted On2016-11-09