Mutagenetix > Incidental Mutation

Incidental Mutation 'R5692:Mrc2'

443742

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

043179-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5692 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105183469-105241965 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105227468 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 567 (V567D)

Ref Sequence

ENSEMBL: ENSMUSP00000021038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

AlphaFold

Q64449

Predicted Effect

probably damaging
Transcript: ENSMUST00000021038
AA Change: V567D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: V567D

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100335
AA Change: V567D

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: V567D

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142905

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151135

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	G	A	9: 8,221,991 (GRCm39)		noncoding transcript	Het
Adcy10	A	G	1: 165,342,875 (GRCm39)	N247S	probably benign	Het
Ago3	T	C	4: 126,248,862 (GRCm39)		probably null	Het
Aldh16a1	A	G	7: 44,797,223 (GRCm39)	V168A	probably damaging	Het
Aqp7	G	A	4: 41,035,510 (GRCm39)	T115I	probably benign	Het
Arhgap26	T	A	18: 39,254,945 (GRCm39)	V274E	probably damaging	Het
Clec4d	T	C	6: 123,245,104 (GRCm39)		probably null	Het
Dennd4b	T	C	3: 90,185,090 (GRCm39)	Y1166H	probably damaging	Het
Egln3	T	C	12: 54,227,447 (GRCm39)		probably null	Het
Fetub	C	T	16: 22,751,081 (GRCm39)	R143C	probably damaging	Het
Fhad1	T	A	4: 141,690,768 (GRCm39)	M434L	probably benign	Het
Gfm1	T	G	3: 67,342,955 (GRCm39)	M163R	probably damaging	Het
Isg15	A	T	4: 156,284,279 (GRCm39)	L83Q	probably damaging	Het
Ly9	GCCTTTGGGGGACAATTCC	GCC	1: 171,432,755 (GRCm39)		probably null	Het
Med1	G	T	11: 98,047,206 (GRCm39)		probably benign	Het
Nnmt	G	T	9: 48,514,780 (GRCm39)	T79K	probably benign	Het
Opn1sw	G	A	6: 29,379,840 (GRCm39)		probably benign	Het
Optc	G	T	1: 133,828,714 (GRCm39)		probably benign	Het
Pcdh17	C	T	14: 84,685,980 (GRCm39)	P816S	probably benign	Het
Pcdhb15	T	C	18: 37,607,502 (GRCm39)	S245P	probably benign	Het
Pcdhb18	G	A	18: 37,623,537 (GRCm39)	R289Q	probably benign	Het
Sacs	T	C	14: 61,445,288 (GRCm39)	F2445L	probably benign	Het
Sel1l	T	C	12: 91,778,652 (GRCm39)	N721S	probably benign	Het
Slc35e2	C	T	4: 155,694,483 (GRCm39)	P10L	probably benign	Het
Slc7a11	C	G	3: 50,326,780 (GRCm39)	V494L	probably benign	Het
Sulf2	C	A	2: 165,923,426 (GRCm39)	A598S	probably benign	Het
Tph2	A	T	10: 115,020,732 (GRCm39)	D21E	probably damaging	Het
Trf	T	C	9: 103,103,324 (GRCm39)	Y110C	possibly damaging	Het
Ttn	C	T	2: 76,628,202 (GRCm39)	E14653K	possibly damaging	Het
Vmn2r18	A	G	5: 151,485,724 (GRCm39)	I590T	possibly damaging	Het
Zfp607b	G	T	7: 27,402,889 (GRCm39)	K448N	probably benign	Het
Zfp689	T	C	7: 127,048,071 (GRCm39)		probably benign	Het
Zfp709	C	T	8: 72,643,999 (GRCm39)	P476L	probably damaging	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105,219,567 (GRCm39)	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105,238,469 (GRCm39)	nonsense	probably null
IGL01751:Mrc2	APN	11	105,216,560 (GRCm39)	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105,227,503 (GRCm39)	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105,216,547 (GRCm39)	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105,227,533 (GRCm39)	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105,224,446 (GRCm39)	splice site	probably benign
IGL02940:Mrc2	APN	11	105,231,997 (GRCm39)	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105,216,397 (GRCm39)	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105,238,692 (GRCm39)	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105,238,518 (GRCm39)	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105,231,647 (GRCm39)	missense	probably benign
R1233:Mrc2	UTSW	11	105,239,241 (GRCm39)	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R1458:Mrc2	UTSW	11	105,228,598 (GRCm39)	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105,238,551 (GRCm39)	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105,227,482 (GRCm39)	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105,229,619 (GRCm39)	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105,228,546 (GRCm39)	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105,238,682 (GRCm39)	splice site	probably null
R2165:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2265:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2266:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2267:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2268:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2269:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2270:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2271:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2272:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2296:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2298:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2300:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2326:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2518:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2519:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2520:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R2895:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3029:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3030:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3079:Mrc2	UTSW	11	105,227,539 (GRCm39)	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3149:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3150:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3420:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3422:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3441:Mrc2	UTSW	11	105,238,542 (GRCm39)	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3731:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3800:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3820:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3821:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3837:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3838:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3849:Mrc2	UTSW	11	105,183,729 (GRCm39)	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105,183,729 (GRCm39)	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105,238,058 (GRCm39)	splice site	probably benign
R3932:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3933:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R3971:Mrc2	UTSW	11	105,218,857 (GRCm39)	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4107:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4113:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4274:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4399:Mrc2	UTSW	11	105,227,484 (GRCm39)	nonsense	probably null
R4477:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4478:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4493:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4494:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4495:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4547:Mrc2	UTSW	11	105,227,467 (GRCm39)	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4601:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4602:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4603:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4610:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4611:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4637:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4672:Mrc2	UTSW	11	105,233,923 (GRCm39)	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4675:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4693:Mrc2	UTSW	11	105,234,528 (GRCm39)	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4707:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4791:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4792:Mrc2	UTSW	11	105,239,257 (GRCm39)	splice site	probably null
R4888:Mrc2	UTSW	11	105,232,034 (GRCm39)	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105,234,408 (GRCm39)	missense	probably benign
R5600:Mrc2	UTSW	11	105,224,492 (GRCm39)	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105,227,040 (GRCm39)	nonsense	probably null
R5706:Mrc2	UTSW	11	105,223,169 (GRCm39)	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105,228,639 (GRCm39)	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105,237,615 (GRCm39)	missense	probably benign
R6146:Mrc2	UTSW	11	105,216,470 (GRCm39)	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105,237,646 (GRCm39)	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105,240,669 (GRCm39)	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105,240,708 (GRCm39)	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105,233,906 (GRCm39)	splice site	probably null
R6680:Mrc2	UTSW	11	105,216,579 (GRCm39)	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105,219,244 (GRCm39)	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105,239,461 (GRCm39)	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105,223,062 (GRCm39)	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105,216,629 (GRCm39)	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105,220,061 (GRCm39)	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105,183,609 (GRCm39)	start gained	probably benign
R7537:Mrc2	UTSW	11	105,183,623 (GRCm39)	missense	probably benign
R7640:Mrc2	UTSW	11	105,223,121 (GRCm39)	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105,237,285 (GRCm39)	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105,223,092 (GRCm39)	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105,238,829 (GRCm39)	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105,239,181 (GRCm39)	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105,234,333 (GRCm39)	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105,223,137 (GRCm39)	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105,223,137 (GRCm39)	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105,238,132 (GRCm39)	missense	possibly damaging	0.62
R8771:Mrc2	UTSW	11	105,240,596 (GRCm39)	missense	probably benign
R8787:Mrc2	UTSW	11	105,238,465 (GRCm39)	missense	probably benign
R8925:Mrc2	UTSW	11	105,216,334 (GRCm39)	missense	probably benign	0.00
R8927:Mrc2	UTSW	11	105,216,334 (GRCm39)	missense	probably benign	0.00
R8991:Mrc2	UTSW	11	105,229,740 (GRCm39)	missense	probably benign
R9017:Mrc2	UTSW	11	105,216,711 (GRCm39)	missense	probably damaging	1.00
R9096:Mrc2	UTSW	11	105,231,398 (GRCm39)	missense	probably damaging	1.00
R9097:Mrc2	UTSW	11	105,231,398 (GRCm39)	missense	probably damaging	1.00
R9223:Mrc2	UTSW	11	105,220,093 (GRCm39)	missense	probably damaging	1.00
R9471:Mrc2	UTSW	11	105,234,559 (GRCm39)	missense	probably benign	0.03
R9531:Mrc2	UTSW	11	105,240,731 (GRCm39)	missense	possibly damaging	0.82
T0970:Mrc2	UTSW	11	105,238,453 (GRCm39)	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105,238,453 (GRCm39)	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105,238,301 (GRCm39)	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105,238,186 (GRCm39)	nonsense	probably null
Z1176:Mrc2	UTSW	11	105,232,202 (GRCm39)	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCAGGTTTGGACTGAATGGCC -3'
(R):5'- TAAGTCCCGACACAGCTCTG -3'

Sequencing Primer
(F):5'- CAGTAGTGGGAGTCTGGTTAC -3'
(R):5'- ACACAGCTCTGGGTCCAC -3'

Posted On

2016-11-09