Incidental Mutation 'R9471:Mrc2'
ID 715486
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Name mannose receptor, C type 2
Synonyms Endo180, uPARAP, novel lectin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9471 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 105292643-105351139 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105343733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1026 (S1026R)
Ref Sequence ENSEMBL: ENSMUSP00000021038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
AlphaFold Q64449
Predicted Effect probably benign
Transcript: ENSMUST00000021038
AA Change: S1026R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: S1026R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,567,057 K368E probably damaging Het
Adgrl2 T C 3: 148,852,729 T448A probably benign Het
Aff4 C T 11: 53,380,646 P337S probably benign Het
Alg12 G A 15: 88,806,418 Q406* probably null Het
Anapc5 T C 5: 122,806,245 Y302C probably damaging Het
Apol7a A G 15: 77,389,480 S261P possibly damaging Het
Atad5 G T 11: 80,132,698 K1545N possibly damaging Het
Atp6v1f T A 6: 29,467,942 D42E probably benign Het
Bcl6 T A 16: 23,973,107 N166Y probably benign Het
Btbd7 C T 12: 102,793,886 R601Q probably damaging Het
Casp1 A G 9: 5,304,187 E287G probably benign Het
Cd300c A T 11: 114,956,390 V193E probably damaging Het
Cd300lg T A 11: 102,054,094 S377T probably benign Het
Ceacam13 T A 7: 18,019,087 *264R probably null Het
Clasrp G A 7: 19,585,247 R498* probably null Het
Clec4n T A 6: 123,244,546 N146K probably benign Het
Cntln T A 4: 85,049,782 V746E possibly damaging Het
Defa29 T C 8: 21,326,885 T31A possibly damaging Het
Egr4 A G 6: 85,512,713 S122P possibly damaging Het
Fam221a T G 6: 49,372,586 D28E probably damaging Het
Fanca G A 8: 123,274,158 T1161I possibly damaging Het
Frat2 A G 19: 41,847,674 S80P probably benign Het
Fuk T C 8: 110,883,409 E991G probably benign Het
Gm13089 T A 4: 143,697,179 T347S probably damaging Het
Gse1 C A 8: 120,575,106 S985R unknown Het
H2-M3 T A 17: 37,271,097 I148N probably damaging Het
Hs6st3 G T 14: 119,138,823 V137L probably damaging Het
Ighv1-42 T A 12: 114,937,307 M53L probably benign Het
Klhl24 C T 16: 20,122,985 T561I Het
Klhl26 C G 8: 70,452,153 G369A probably damaging Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lrrd1 A T 5: 3,863,980 D750V Het
Mc5r A G 18: 68,339,056 D162G probably damaging Het
Nf1 A G 11: 79,545,369 H1945R probably damaging Het
Nr4a2 A G 2: 57,112,102 M113T probably benign Het
Obox2 G A 7: 15,397,188 G73D probably damaging Het
Olfr330 A T 11: 58,529,529 C152* probably null Het
Olfr366 G A 2: 37,220,388 A300T probably damaging Het
Pappa2 C T 1: 158,814,459 M1342I probably benign Het
Pla2g6 A T 15: 79,317,839 L44Q probably damaging Het
Pnpla1 A T 17: 28,880,999 Q280L probably benign Het
Prdm1 C T 10: 44,450,178 G117S probably damaging Het
Prss36 A T 7: 127,946,433 F6I probably benign Het
Sat2 A G 11: 69,622,899 Y81C probably damaging Het
Sbspon T C 1: 15,892,453 D67G probably benign Het
Shank2 G A 7: 144,411,015 V787M possibly damaging Het
Stoml1 A T 9: 58,256,685 I96F probably damaging Het
Tet2 C T 3: 133,485,919 G918D probably damaging Het
Tgm4 A G 9: 123,040,379 I8V probably benign Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Ttn C T 2: 76,768,502 V19356M probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r67 A C 7: 85,150,515 probably null Het
Wdr90 C A 17: 25,861,041 V107L possibly damaging Het
Zfp316 T C 5: 143,255,406 D286G unknown Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zscan18 T C 7: 12,774,416 T386A possibly damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7422:Mrc2 UTSW 11 105292783 start gained probably benign
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
R7885:Mrc2 UTSW 11 105332266 missense probably damaging 0.98
R7976:Mrc2 UTSW 11 105348003 missense possibly damaging 0.74
R8042:Mrc2 UTSW 11 105348355 missense probably damaging 0.98
R8096:Mrc2 UTSW 11 105343507 missense probably damaging 1.00
R8353:Mrc2 UTSW 11 105332311 missense probably damaging 0.98
R8453:Mrc2 UTSW 11 105332311 missense probably damaging 0.98
R8519:Mrc2 UTSW 11 105347306 missense possibly damaging 0.62
R8771:Mrc2 UTSW 11 105349770 missense probably benign
R8787:Mrc2 UTSW 11 105347639 missense probably benign
R8925:Mrc2 UTSW 11 105325508 missense probably benign 0.00
R8927:Mrc2 UTSW 11 105325508 missense probably benign 0.00
R8991:Mrc2 UTSW 11 105338914 missense probably benign
R9017:Mrc2 UTSW 11 105325885 missense probably damaging 1.00
R9096:Mrc2 UTSW 11 105340572 missense probably damaging 1.00
R9097:Mrc2 UTSW 11 105340572 missense probably damaging 1.00
R9223:Mrc2 UTSW 11 105329267 missense probably damaging 1.00
R9531:Mrc2 UTSW 11 105349905 missense possibly damaging 0.82
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Z1176:Mrc2 UTSW 11 105341376 missense possibly damaging 0.94
Z1176:Mrc2 UTSW 11 105347360 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCCACCTTCAGCCTTAGG -3'
(R):5'- GCATATTTGACTCCATGTGGTG -3'

Sequencing Primer
(F):5'- CCTTAGGAGGCTGCCCC -3'
(R):5'- ATCTGCATGCACATGTACATATAC -3'
Posted On 2022-06-15