Incidental Mutation 'R0553:Nacc2'
ID 45266
Institutional Source Beutler Lab
Gene Symbol Nacc2
Ensembl Gene ENSMUSG00000026932
Gene Name nucleus accumbens associated 2, BEN and BTB (POZ) domain containing
Synonyms 0610020I02Rik, C030048H19Rik, Btbd14a
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 26055535-26123220 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26089590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 278 (E278V)
Ref Sequence ENSEMBL: ENSMUSP00000109796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028300] [ENSMUST00000114159] [ENSMUST00000140993]
AlphaFold Q9DCM7
Predicted Effect possibly damaging
Transcript: ENSMUST00000028300
AA Change: E278V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028300
Gene: ENSMUSG00000026932
AA Change: E278V

DomainStartEndE-ValueType
BTB 30 124 8.41e-23 SMART
low complexity region 198 213 N/A INTRINSIC
low complexity region 264 271 N/A INTRINSIC
BEN 371 449 4.33e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114159
AA Change: E278V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109796
Gene: ENSMUSG00000026932
AA Change: E278V

DomainStartEndE-ValueType
BTB 30 124 8.41e-23 SMART
low complexity region 198 213 N/A INTRINSIC
low complexity region 264 271 N/A INTRINSIC
BEN 371 449 4.33e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133212
Predicted Effect probably benign
Transcript: ENSMUST00000140993
SMART Domains Protein: ENSMUSP00000120198
Gene: ENSMUSG00000026932

DomainStartEndE-ValueType
Pfam:BTB 20 85 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152133
Meta Mutation Damage Score 0.1235 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Nacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Nacc2 APN 2 26089690 missense probably benign
IGL00906:Nacc2 APN 2 26061666 missense probably damaging 1.00
IGL02122:Nacc2 APN 2 26089948 missense probably benign 0.04
IGL02836:Nacc2 APN 2 26090317 missense probably damaging 1.00
IGL03355:Nacc2 APN 2 26062237 missense probably damaging 1.00
R0239:Nacc2 UTSW 2 26062261 missense probably damaging 1.00
R0239:Nacc2 UTSW 2 26062261 missense probably damaging 1.00
R0326:Nacc2 UTSW 2 26060333 missense probably damaging 1.00
R1743:Nacc2 UTSW 2 26060143 missense probably benign
R2172:Nacc2 UTSW 2 26060223 missense probably benign 0.00
R2497:Nacc2 UTSW 2 26089568 nonsense probably null
R4027:Nacc2 UTSW 2 26060336 missense probably benign 0.11
R4724:Nacc2 UTSW 2 26090173 missense probably damaging 1.00
R5045:Nacc2 UTSW 2 26090138 splice site probably null
R5151:Nacc2 UTSW 2 26090353 missense probably damaging 1.00
R5198:Nacc2 UTSW 2 26060334 missense probably benign 0.22
R5905:Nacc2 UTSW 2 26061578 missense probably damaging 1.00
R6028:Nacc2 UTSW 2 26061578 missense probably damaging 1.00
R6257:Nacc2 UTSW 2 26060408 missense probably damaging 1.00
R6924:Nacc2 UTSW 2 26090029 missense probably damaging 0.97
R8263:Nacc2 UTSW 2 26062228 missense probably damaging 0.99
R8936:Nacc2 UTSW 2 26062204 missense probably benign 0.16
R9035:Nacc2 UTSW 2 26061593 missense probably damaging 1.00
R9200:Nacc2 UTSW 2 26090106 missense probably damaging 0.98
R9395:Nacc2 UTSW 2 26060116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATAGAGACCTTCCACAGCAGG -3'
(R):5'- GGCTTCTAAACGCCCACTAGAGAC -3'

Sequencing Primer
(F):5'- GCAGGCTACAATCATCAGAAAG -3'
(R):5'- CCTCTGAAGCTGCCTCG -3'
Posted On 2013-06-11