Mutagenetix > Incidental Mutation

Incidental Mutation 'R0553:Mmp17'

45280

Institutional Source

Beutler Lab

Gene Symbol

Mmp17

Ensembl Gene

ENSMUSG00000029436

Gene Name

matrix metallopeptidase 17

Synonyms

membrane type-4 matrix metalloproteinase, MT4-MMP

MMRRC Submission

038745-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R0553 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

129584169-129611099 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 129598670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 298 (S298A)

Ref Sequence

ENSEMBL: ENSMUSP00000031390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031390]

AlphaFold

Q9R0S3

Predicted Effect

probably benign
Transcript: ENSMUST00000031390
AA Change: S298A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000031390
Gene: ENSMUSG00000029436
AA Change: S298A

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
Pfam:PG_binding_1	44	104	5e-15	PFAM
ZnMc	128	295	8.26e-47	SMART
low complexity region	308	320	N/A	INTRINSIC
HX	340	384	3.17e-8	SMART
HX	389	432	2.59e-13	SMART
HX	435	481	6.39e-13	SMART
HX	483	527	1.1e-7	SMART
low complexity region	563	578	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177802

Meta Mutation Damage Score

0.1408

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

Strain: 3604575; 3777020
FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit dysfunctional vascular smooth muscle cells and altered extracellular matrix in the vessel wall leading to an increased susceptibility to angiotensin-II-induced thoracic aortic aneurysm. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal morphology, clinical chemistry, hematology and behavior. Mice homozygous for a reporter/null allele exhibit normal growth, fertility, and lifespan but show subtle renal developmental defects, hypodipsia, and elevated urine osmolarity. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,682,686	I729V	probably damaging	Het
9530002B09Rik	A	T	4: 122,702,335	M120L	unknown	Het
Adamts13	T	A	2: 26,991,334	C774*	probably null	Het
Amh	A	G	10: 80,806,176		probably benign	Het
Ccdc173	C	A	2: 69,789,441	R8L	probably damaging	Het
Cd40	G	A	2: 165,070,741	R204Q	probably benign	Het
Clhc1	A	C	11: 29,561,366		probably benign	Het
Fbxl17	G	A	17: 63,356,851	R67C	probably damaging	Het
Flg2	A	T	3: 93,203,584	H973L	unknown	Het
Fut2	T	A	7: 45,651,274	I25F	probably damaging	Het
Galnt7	T	C	8: 57,552,430		probably benign	Het
Gm438	T	A	4: 144,777,415	I389L	possibly damaging	Het
Gm7534	T	C	4: 134,202,518	T159A	possibly damaging	Het
Gm8909	G	T	17: 36,168,057	P100Q	probably damaging	Het
Gmppb	A	T	9: 108,049,797	M56L	probably benign	Het
Grm3	C	A	5: 9,570,048	A399S	probably benign	Het
Hey2	G	A	10: 30,840,489		probably benign	Het
Ift172	A	G	5: 31,275,842		probably benign	Het
Kcnh5	C	A	12: 75,137,673	C92F	probably benign	Het
Kdm1a	T	C	4: 136,555,298	D229G	probably damaging	Het
Klf11	C	G	12: 24,655,090	P164R	probably benign	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Krtcap3	T	C	5: 31,251,803	V6A	probably benign	Het
Ltbr	A	C	6: 125,313,388		probably null	Het
Nacc2	T	A	2: 26,089,590	E278V	possibly damaging	Het
Olfr175-ps1	A	T	16: 58,824,155	Y185N	probably damaging	Het
Olfr875	T	A	9: 37,773,331	I224N	probably benign	Het
Otop2	C	T	11: 115,329,462	A376V	probably damaging	Het
Pdia2	T	C	17: 26,196,243	E504G	probably damaging	Het
Pdzph1	C	T	17: 58,922,727	V979M	probably damaging	Het
Pou5f1	A	G	17: 35,509,477	K86R	possibly damaging	Het
Ptprq	A	G	10: 107,710,627	F269L	probably benign	Het
Rb1	A	T	14: 73,211,712	C659*	probably null	Het
Rnf8	T	C	17: 29,621,639		probably null	Het
Rras	T	G	7: 45,020,556	I137M	probably benign	Het
Slc38a9	A	T	13: 112,714,198	H372L	probably damaging	Het
Spata9	T	C	13: 75,977,779		probably null	Het
Tas2r115	T	C	6: 132,737,959	T10A	probably benign	Het
Ttn	T	C	2: 76,798,893	E12621G	probably damaging	Het
Unc80	A	T	1: 66,506,669	I460F	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zbtb24	C	T	10: 41,451,997	A293V	possibly damaging	Het

Other mutations in Mmp17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Mmp17	APN	5	129606408	missense	probably benign	0.00
IGL01602:Mmp17	APN	5	129601944	missense	probably benign	0.00
IGL01605:Mmp17	APN	5	129601944	missense	probably benign	0.00
IGL01782:Mmp17	APN	5	129602141	missense	probably damaging	1.00
IGL01986:Mmp17	APN	5	129596628	missense	probably damaging	1.00
IGL02096:Mmp17	APN	5	129598688	nonsense	probably null
IGL02160:Mmp17	APN	5	129595569	missense	possibly damaging	0.91
IGL03075:Mmp17	APN	5	129595074	missense	probably damaging	1.00
P0005:Mmp17	UTSW	5	129596631	missense	probably benign	0.00
R0125:Mmp17	UTSW	5	129594582	missense	possibly damaging	0.88
R1521:Mmp17	UTSW	5	129595088	splice site	probably null
R1938:Mmp17	UTSW	5	129602126	missense	probably damaging	1.00
R2151:Mmp17	UTSW	5	129605661	missense	probably benign	0.01
R4908:Mmp17	UTSW	5	129605666	nonsense	probably null
R4970:Mmp17	UTSW	5	129602165	missense	possibly damaging	0.51
R5096:Mmp17	UTSW	5	129605563	missense	probably damaging	1.00
R5112:Mmp17	UTSW	5	129602165	missense	possibly damaging	0.51
R5178:Mmp17	UTSW	5	129595058	missense	probably damaging	1.00
R5304:Mmp17	UTSW	5	129594614	missense	probably null	0.89
R5341:Mmp17	UTSW	5	129602129	missense	possibly damaging	0.50
R6341:Mmp17	UTSW	5	129601955	missense	probably damaging	0.99
R6501:Mmp17	UTSW	5	129606405	missense	probably benign	0.00
R7257:Mmp17	UTSW	5	129595633	missense	probably benign	0.03
R7371:Mmp17	UTSW	5	129605772	missense	probably null	0.98
R7546:Mmp17	UTSW	5	129596589	missense	probably damaging	1.00
R8026:Mmp17	UTSW	5	129595084	critical splice donor site	probably null
R8370:Mmp17	UTSW	5	129605578	missense	probably damaging	1.00
R8525:Mmp17	UTSW	5	129602207	missense	probably damaging	1.00
R8708:Mmp17	UTSW	5	129595422	missense	possibly damaging	0.67
R8803:Mmp17	UTSW	5	129598709	nonsense	probably null
R8878:Mmp17	UTSW	5	129606314	missense	probably damaging	1.00
R8882:Mmp17	UTSW	5	129601944	missense	probably benign	0.00
R9399:Mmp17	UTSW	5	129594622	nonsense	probably null
R9404:Mmp17	UTSW	5	129605677	missense	possibly damaging	0.89
R9528:Mmp17	UTSW	5	129606328	missense	probably benign	0.00
W0251:Mmp17	UTSW	5	129595527	missense	probably benign	0.09
Y5377:Mmp17	UTSW	5	129595530	missense	probably damaging	1.00
Y5380:Mmp17	UTSW	5	129595530	missense	probably damaging	1.00
Z1177:Mmp17	UTSW	5	129595661	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCTCCTTCACCGGAGTCAGATCAG -3'
(R):5'- AAAGTGTGCCCCAGAACCAGTCAG -3'

Sequencing Primer
(F):5'- TGGGGCATAGTACACTTCAC -3'
(R):5'- GCACATGCAACATGCCTTC -3'

Posted On

2013-06-11