Incidental Mutation 'R0553:Mmp17'
ID 45280
Institutional Source Beutler Lab
Gene Symbol Mmp17
Ensembl Gene ENSMUSG00000029436
Gene Name matrix metallopeptidase 17
Synonyms membrane type-4 matrix metalloproteinase, MT4-MMP
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R0553 (G1)
Quality Score 211
Status Validated
Chromosome 5
Chromosomal Location 129584169-129611099 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 129598670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 298 (S298A)
Ref Sequence ENSEMBL: ENSMUSP00000031390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031390]
AlphaFold Q9R0S3
Predicted Effect probably benign
Transcript: ENSMUST00000031390
AA Change: S298A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031390
Gene: ENSMUSG00000029436
AA Change: S298A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:PG_binding_1 44 104 5e-15 PFAM
ZnMc 128 295 8.26e-47 SMART
low complexity region 308 320 N/A INTRINSIC
HX 340 384 3.17e-8 SMART
HX 389 432 2.59e-13 SMART
HX 435 481 6.39e-13 SMART
HX 483 527 1.1e-7 SMART
low complexity region 563 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177802
Meta Mutation Damage Score 0.1408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype Strain: 3604575; 3777020
FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit dysfunctional vascular smooth muscle cells and altered extracellular matrix in the vessel wall leading to an increased susceptibility to angiotensin-II-induced thoracic aortic aneurysm. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal morphology, clinical chemistry, hematology and behavior. Mice homozygous for a reporter/null allele exhibit normal growth, fertility, and lifespan but show subtle renal developmental defects, hypodipsia, and elevated urine osmolarity. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Mmp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mmp17 APN 5 129606408 missense probably benign 0.00
IGL01602:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01605:Mmp17 APN 5 129601944 missense probably benign 0.00
IGL01782:Mmp17 APN 5 129602141 missense probably damaging 1.00
IGL01986:Mmp17 APN 5 129596628 missense probably damaging 1.00
IGL02096:Mmp17 APN 5 129598688 nonsense probably null
IGL02160:Mmp17 APN 5 129595569 missense possibly damaging 0.91
IGL03075:Mmp17 APN 5 129595074 missense probably damaging 1.00
P0005:Mmp17 UTSW 5 129596631 missense probably benign 0.00
R0125:Mmp17 UTSW 5 129594582 missense possibly damaging 0.88
R1521:Mmp17 UTSW 5 129595088 splice site probably null
R1938:Mmp17 UTSW 5 129602126 missense probably damaging 1.00
R2151:Mmp17 UTSW 5 129605661 missense probably benign 0.01
R4908:Mmp17 UTSW 5 129605666 nonsense probably null
R4970:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5096:Mmp17 UTSW 5 129605563 missense probably damaging 1.00
R5112:Mmp17 UTSW 5 129602165 missense possibly damaging 0.51
R5178:Mmp17 UTSW 5 129595058 missense probably damaging 1.00
R5304:Mmp17 UTSW 5 129594614 missense probably null 0.89
R5341:Mmp17 UTSW 5 129602129 missense possibly damaging 0.50
R6341:Mmp17 UTSW 5 129601955 missense probably damaging 0.99
R6501:Mmp17 UTSW 5 129606405 missense probably benign 0.00
R7257:Mmp17 UTSW 5 129595633 missense probably benign 0.03
R7371:Mmp17 UTSW 5 129605772 missense probably null 0.98
R7546:Mmp17 UTSW 5 129596589 missense probably damaging 1.00
R8026:Mmp17 UTSW 5 129595084 critical splice donor site probably null
R8370:Mmp17 UTSW 5 129605578 missense probably damaging 1.00
R8525:Mmp17 UTSW 5 129602207 missense probably damaging 1.00
R8708:Mmp17 UTSW 5 129595422 missense possibly damaging 0.67
R8803:Mmp17 UTSW 5 129598709 nonsense probably null
R8878:Mmp17 UTSW 5 129606314 missense probably damaging 1.00
R8882:Mmp17 UTSW 5 129601944 missense probably benign 0.00
R9399:Mmp17 UTSW 5 129594622 nonsense probably null
R9404:Mmp17 UTSW 5 129605677
W0251:Mmp17 UTSW 5 129595527 missense probably benign 0.09
Y5377:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Y5380:Mmp17 UTSW 5 129595530 missense probably damaging 1.00
Z1177:Mmp17 UTSW 5 129595661 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTCCTTCACCGGAGTCAGATCAG -3'
(R):5'- AAAGTGTGCCCCAGAACCAGTCAG -3'

Sequencing Primer
(F):5'- TGGGGCATAGTACACTTCAC -3'
(R):5'- GCACATGCAACATGCCTTC -3'
Posted On 2013-06-11