Mutagenetix > Incidental Mutations

Incidental Mutation 'R5889:Astn1'

456196

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

044090-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R5889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158362273-158691781 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 158600380 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 707 (P707L)

Ref Sequence

ENSEMBL: ENSMUSP00000142017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000193599] [ENSMUST00000194369] [ENSMUST00000195311]

Predicted Effect

probably benign
Transcript: ENSMUST00000046110
AA Change: P707L

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: P707L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170718
AA Change: P715L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: P715L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
Blast:MACPF	811	835	3e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000193042
AA Change: P715L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: P715L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193599

SMART Domains

Protein: ENSMUSP00000141498
Gene: ENSMUSG00000026587

Domain	Start	End	E-Value	Type
EGF	101	142	1.1e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194041

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194369
AA Change: P707L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: P707L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
Blast:MACPF	803	828	2e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000195311
AA Change: P707L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: P707L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Meta Mutation Damage Score

0.1560

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.3%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,354,449	E297G	probably damaging	Het
Cep290	T	C	10: 100,499,074	S319P	possibly damaging	Het
Chrna4	A	C	2: 181,028,658	L435W	probably damaging	Het
Cilp	C	A	9: 65,280,343	A1240D	possibly damaging	Het
Col17a1	A	G	19: 47,649,072	F1249S	possibly damaging	Het
Creb3l3	T	C	10: 81,092,533		probably benign	Het
Cyp4f40	C	A	17: 32,675,757	T432N	probably benign	Het
Dsg1c	T	G	18: 20,283,601	I853R	possibly damaging	Het
Ebna1bp2	T	A	4: 118,621,423	D34E	probably damaging	Het
Edc4	C	T	8: 105,888,022	T112I	possibly damaging	Het
Enpep	T	A	3: 129,312,578	Y333F	probably damaging	Het
Exoc6	A	G	19: 37,582,245	H291R	probably damaging	Het
Fbln5	G	T	12: 101,765,226	N236K	probably damaging	Het
Fndc8	A	T	11: 82,898,729	T238S	probably damaging	Het
Frem3	T	C	8: 80,614,288	V1070A	probably damaging	Het
Gabra4	A	T	5: 71,571,891	N515K	possibly damaging	Het
Gemin5	A	G	11: 58,122,355	V1422A	possibly damaging	Het
Gm10118	A	G	10: 63,927,111		probably benign	Het
Grm5	A	G	7: 87,603,073	D177G	probably damaging	Het
Gtf2h4	G	A	17: 35,670,900	P147L	possibly damaging	Het
Hgsnat	T	C	8: 25,963,367	D265G	probably damaging	Het
Hsd17b4	T	A	18: 50,177,209	L513Q	probably damaging	Het
Hsd17b7	A	T	1: 169,955,918	M307K	probably benign	Het
Hspa5	T	C	2: 34,774,617	V361A	probably damaging	Het
Iqgap2	A	G	13: 95,632,042	V1450A	probably benign	Het
Itpr3	A	G	17: 27,115,065	E2037G	probably damaging	Het
Lama5	T	C	2: 180,193,674		probably benign	Het
Manba	G	T	3: 135,524,598	G311*	probably null	Het
Mettl24	T	A	10: 40,746,490	V236E	probably benign	Het
Myh3	A	G	11: 67,086,375	D310G	probably damaging	Het
Ncoa4	A	T	14: 32,166,659		probably benign	Het
Nop56	G	T	2: 130,275,982	R126L	probably damaging	Het
Nos3	C	A	5: 24,368,777		probably benign	Het
Olfr156	T	C	4: 43,820,492	M290V	possibly damaging	Het
Pcdhga3	T	A	18: 37,676,609	V705D	probably damaging	Het
Prom2	C	T	2: 127,529,411	A776T	possibly damaging	Het
Prss48	A	G	3: 85,998,185	I127T	probably damaging	Het
Rtca	T	C	3: 116,499,583	Y193C	possibly damaging	Het
Samd9l	T	C	6: 3,376,460	Y267C	probably damaging	Het
Scube3	A	G	17: 28,160,913	R272G	possibly damaging	Het
Sprr1a	G	T	3: 92,484,644	H17N	probably benign	Het
Ssfa2	T	A	2: 79,657,728	D718E	probably damaging	Het
Stard3	G	C	11: 98,375,535	Q120H	probably benign	Het
Supt6	A	G	11: 78,212,748	I1377T	probably damaging	Het
Svop	A	T	5: 114,065,631	S30T	probably benign	Het
Syne2	T	A	12: 76,072,252	L5882*	probably null	Het
Tanc2	G	T	11: 105,921,807	R1359L	probably benign	Het
Tmc7	A	C	7: 118,566,326	L55R	probably benign	Het
Trappc11	G	A	8: 47,519,578	A320V	probably benign	Het
Ttll8	G	C	15: 88,933,939	P178A	probably damaging	Het
Ttn	T	C	2: 76,730,649	E20809G	probably damaging	Het
Tubb2a	A	T	13: 34,075,468	V113E	possibly damaging	Het
Ube2d1	A	T	10: 71,259,869		probably benign	Het
Usp48	T	C	4: 137,616,412	V452A	probably benign	Het
Vldlr	T	A	19: 27,239,664	I39N	probably damaging	Het
Wbp1l	C	T	19: 46,654,180	R191*	probably null	Het
Zyg11b	C	T	4: 108,237,380	W669*	probably null	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158600319	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158504313	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158580327	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158668631	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158511154	intron	probably benign
IGL02168:Astn1	APN	1	158609341	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158664130	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158510950	splice site	probably benign
IGL02307:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158502408	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158505395	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158688550	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158612395	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158668623	splice site	probably benign
IGL03354:Astn1	APN	1	158688604	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158597209	missense	probably benign	0.20
PIT4366001:Astn1	UTSW	1	158597211	missense	probably benign	0.23
R0024:Astn1	UTSW	1	158684215	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158579724	splice site	probably benign
R0099:Astn1	UTSW	1	158502151	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158688548	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158509891	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158600389	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158472389	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158509890	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158511109	nonsense	probably null
R1027:Astn1	UTSW	1	158580279	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158600365	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158502353	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158579576	splice site	probably benign
R1701:Astn1	UTSW	1	158504307	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158504251	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158601945	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158505316	intron	probably null
R1919:Astn1	UTSW	1	158509971	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158520521	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158609305	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158657120	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158600502	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158472408	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158667609	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158502150	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158657306	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158579666	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158612346	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158572951	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158667532	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158502060	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158579657	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158502032	intron	probably null
R4625:Astn1	UTSW	1	158580294	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158502251	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158612532	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158580363	critical splice donor site	probably null
R5909:Astn1	UTSW	1	158601937	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158509993	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158664121	nonsense	probably null
R6481:Astn1	UTSW	1	158612462	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158511148	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158612472	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158664074	nonsense	probably null
R7062:Astn1	UTSW	1	158688511	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158572987	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158664276	intron	probably null
R7402:Astn1	UTSW	1	158552855	intron	probably benign
R7412:Astn1	UTSW	1	158502349	missense	probably damaging	0.98
R7537:Astn1	UTSW	1	158505386	missense	possibly damaging	0.84
R7537:Astn1	UTSW	1	158667638	splice site	probably null
R7635:Astn1	UTSW	1	158667535	nonsense	probably null
Z1088:Astn1	UTSW	1	158472497	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158597206	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158684096	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCATCCAGTATCTTTCCAAAG -3'
(R):5'- TGGGCAAGAACACTATCTGC -3'

Sequencing Primer
(F):5'- CCAGTATCTTTCCAAAGGAATTGC -3'
(R):5'- GGCAAGAACACTATCTGCATCTTTAG -3'

Posted On

2017-02-15