Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:1810043G02Rik'

46270

Institutional Source

Beutler Lab

Gene Symbol

1810043G02Rik

Ensembl Gene

ENSMUSG00000020284

Gene Name

RIKEN cDNA 1810043G02 gene

Synonyms

D10Jhu13e

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77978524-77986905 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to T at 77984547 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Cysteine at position 250 (*250C)

Ref Sequence

ENSEMBL: ENSMUSP00000101036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000105397] [ENSMUST00000105398]

Predicted Effect

probably benign
Transcript: ENSMUST00000020522

SMART Domains

Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277

Domain	Start	End	E-Value	Type
Pfam:PFK	17	324	4.7e-109	PFAM
Pfam:PFK	401	686	1.9e-98	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105397
AA Change: *250C

SMART Domains

Protein: ENSMUSP00000101036
Gene: ENSMUSG00000020284
AA Change: *250C

Domain	Start	End	E-Value	Type
LRRcap	104	122	3.42e-2	SMART
low complexity region	178	191	N/A	INTRINSIC
low complexity region	210	227	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105398

SMART Domains

Protein: ENSMUSP00000101037
Gene: ENSMUSG00000020284

Domain	Start	End	E-Value	Type
LRRcap	104	122	3.42e-2	SMART
low complexity region	178	191	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116237

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130949

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149074

Meta Mutation Damage Score

0.8484

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in 1810043G02Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02227:1810043G02Rik	APN	10	77982950	missense	possibly damaging	0.62
IGL02376:1810043G02Rik	APN	10	77984554	intron	probably benign
IGL02671:1810043G02Rik	APN	10	77980550	splice site	probably benign
R0145:1810043G02Rik	UTSW	10	77983556	missense	probably benign	0.04
R0347:1810043G02Rik	UTSW	10	77984422	missense	probably damaging	0.96
R0568:1810043G02Rik	UTSW	10	77983038	missense	possibly damaging	0.48
R1778:1810043G02Rik	UTSW	10	77982944	missense	probably benign	0.00
R2279:1810043G02Rik	UTSW	10	77981642	missense	probably damaging	1.00
R2939:1810043G02Rik	UTSW	10	77981673	missense	probably benign	0.00
R4656:1810043G02Rik	UTSW	10	77981616	missense	probably benign	0.01
R4866:1810043G02Rik	UTSW	10	77981579	splice site	probably null
R6539:1810043G02Rik	UTSW	10	77984488	missense	probably benign	0.07
R7016:1810043G02Rik	UTSW	10	77982956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTATCCTGTAAAGGATGCCACCAGC -3'
(R):5'- AGGTGACATCCCTCTCCTGAAGAAG -3'

Sequencing Primer
(F):5'- CAGCCAGGTCTTAGGTCATTC -3'
(R):5'- CATCTCCAAGGGTAGGCTTGATAC -3'

Posted On

2013-06-11