Incidental Mutation 'R5990:Xrcc1'
ID 481941
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 1
Synonyms Xrcc-1
MMRRC Submission 044170-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5990 (G1)
Quality Score 211.009
Status Validated
Chromosome 7
Chromosomal Location 24246124-24272863 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24267293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 381 (V381M)
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063249] [ENSMUST00000205573]
AlphaFold Q60596
Predicted Effect probably damaging
Transcript: ENSMUST00000063249
AA Change: V381M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768
AA Change: V381M

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205564
Predicted Effect probably damaging
Transcript: ENSMUST00000205573
AA Change: V381M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Meta Mutation Damage Score 0.4590 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,285,123 (GRCm39) M11L probably benign Het
Acad10 A G 5: 121,783,468 (GRCm39) L319P probably damaging Het
Adam12 C A 7: 133,533,465 (GRCm39) C471F probably damaging Het
Arfgef1 A G 1: 10,243,146 (GRCm39) Y1065H probably damaging Het
Atp8b3 G A 10: 80,361,531 (GRCm39) T797M possibly damaging Het
Auts2 G A 5: 131,505,734 (GRCm39) probably benign Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Ccdc146 A G 5: 21,523,180 (GRCm39) S286P probably benign Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmtr1 T C 17: 29,921,135 (GRCm39) Y794H probably benign Het
Copb2 A G 9: 98,452,378 (GRCm39) E54G probably damaging Het
Ctsk A T 3: 95,408,767 (GRCm39) H77L probably damaging Het
Dnah3 T C 7: 119,672,764 (GRCm39) Y546C probably benign Het
Ephb2 A T 4: 136,423,366 (GRCm39) V304E probably benign Het
Ern1 C T 11: 106,302,595 (GRCm39) V420I probably benign Het
Esrrg A T 1: 187,930,995 (GRCm39) E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 (GRCm39) F189V probably damaging Het
Foxl1 G T 8: 121,855,160 (GRCm39) A154S probably damaging Het
Frs3 A G 17: 48,012,602 (GRCm39) D103G possibly damaging Het
Gdpd4 A G 7: 97,690,137 (GRCm39) T610A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm4847 C T 1: 166,470,942 (GRCm39) S36N probably benign Het
Grm8 G T 6: 27,363,623 (GRCm39) L631I probably damaging Het
Ints9 T A 14: 65,276,777 (GRCm39) L648Q probably damaging Het
Kansl1l T C 1: 66,774,885 (GRCm39) H647R probably damaging Het
Kcnq1 T A 7: 142,815,105 (GRCm39) H501Q probably damaging Het
Kctd20 T C 17: 29,185,884 (GRCm39) L409P probably benign Het
Kiss1r A G 10: 79,754,541 (GRCm39) T12A probably benign Het
Kndc1 T A 7: 139,507,333 (GRCm39) V1173E probably damaging Het
Kprp T C 3: 92,732,081 (GRCm39) E323G probably damaging Het
Krtap10-4 A T 10: 77,662,441 (GRCm39) probably benign Het
Lrrc37a A G 11: 103,391,784 (GRCm39) Y1214H probably benign Het
Lysmd3 G A 13: 81,817,707 (GRCm39) G228D probably damaging Het
Muc16 G A 9: 18,570,539 (GRCm39) A660V unknown Het
Muc5b T C 7: 141,411,898 (GRCm39) C1615R unknown Het
Nans A T 4: 46,489,441 (GRCm39) N28I probably damaging Het
Nlrp4b C T 7: 10,448,418 (GRCm39) S207L possibly damaging Het
Nrdc T G 4: 108,876,268 (GRCm39) F355V probably damaging Het
Nrip2 C T 6: 128,376,979 (GRCm39) probably benign Het
Nufip1 C T 14: 76,351,628 (GRCm39) P161L probably damaging Het
Ogdhl C T 14: 32,049,071 (GRCm39) H114Y possibly damaging Het
Opa1 T A 16: 29,405,836 (GRCm39) W134R probably damaging Het
Or4k45 T A 2: 111,395,019 (GRCm39) I257F probably damaging Het
Or8a1b G T 9: 37,623,406 (GRCm39) H56Q probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Patl2 T C 2: 121,954,965 (GRCm39) D361G probably damaging Het
Pcx A G 19: 4,671,294 (GRCm39) D1172G probably damaging Het
Phax A G 18: 56,708,675 (GRCm39) T58A probably benign Het
Phf11b T A 14: 59,562,375 (GRCm39) I177L possibly damaging Het
Pole T A 5: 110,450,010 (GRCm39) V819D probably damaging Het
Poll T C 19: 45,541,594 (GRCm39) D458G possibly damaging Het
Polr2m G A 9: 71,386,602 (GRCm39) probably null Het
Ppp1r9a C A 6: 5,134,660 (GRCm39) H928N probably benign Het
Prdm2 T C 4: 142,896,683 (GRCm39) N102D probably damaging Het
Rbm45 A T 2: 76,200,756 (GRCm39) D95V probably benign Het
Rdh19 A G 10: 127,695,463 (GRCm39) M226V probably benign Het
Rev3l T G 10: 39,699,807 (GRCm39) S1435A probably benign Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rhobtb2 T C 14: 70,033,818 (GRCm39) N469S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rps6ka1 A G 4: 133,593,708 (GRCm39) I177T probably damaging Het
Samd12 T A 15: 53,583,019 (GRCm39) D105V probably damaging Het
Setd3 A T 12: 108,126,594 (GRCm39) D88E probably benign Het
Sfmbt2 G T 2: 10,584,192 (GRCm39) V850L possibly damaging Het
Slc26a10 C A 10: 127,014,627 (GRCm39) A195S possibly damaging Het
Smcp C A 3: 92,491,557 (GRCm39) A97S unknown Het
Stxbp5 G A 10: 9,711,677 (GRCm39) H248Y probably damaging Het
Syne2 T C 12: 76,070,918 (GRCm39) L4457P probably benign Het
Tbx3 A G 5: 119,818,594 (GRCm39) T390A probably benign Het
Tmeff2 G A 1: 51,018,601 (GRCm39) W194* probably null Het
Tmem120b G A 5: 123,242,544 (GRCm39) R174Q probably damaging Het
Trio A G 15: 27,891,545 (GRCm39) V402A probably benign Het
Ttll2 C A 17: 7,619,766 (GRCm39) G54W possibly damaging Het
Uba7 G A 9: 107,858,433 (GRCm39) V786M probably damaging Het
Vmn2r32 T C 7: 7,482,809 (GRCm39) E55G probably damaging Het
Wdr35 A G 12: 9,066,511 (GRCm39) D724G probably damaging Het
Zdhhc11 T A 13: 74,127,303 (GRCm39) W227R probably benign Het
Zfp341 T C 2: 154,487,579 (GRCm39) S681P probably damaging Het
Zfp735 T A 11: 73,581,174 (GRCm39) D70E possibly damaging Het
Zmat4 G A 8: 24,419,279 (GRCm39) A104T probably damaging Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24,247,309 (GRCm39) critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24,272,767 (GRCm39) utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24,266,467 (GRCm39) nonsense probably null
IGL02433:Xrcc1 APN 7 24,264,979 (GRCm39) missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24,272,719 (GRCm39) nonsense probably null
Bilberry UTSW 7 24,269,643 (GRCm39) missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24,269,642 (GRCm39) missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24,269,744 (GRCm39) splice site probably benign
R0612:Xrcc1 UTSW 7 24,269,744 (GRCm39) splice site probably benign
R1234:Xrcc1 UTSW 7 24,267,270 (GRCm39) missense possibly damaging 0.71
R1577:Xrcc1 UTSW 7 24,265,052 (GRCm39) nonsense probably null
R1796:Xrcc1 UTSW 7 24,247,252 (GRCm39) missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24,270,000 (GRCm39) missense possibly damaging 0.65
R3788:Xrcc1 UTSW 7 24,266,333 (GRCm39) missense probably benign 0.08
R3794:Xrcc1 UTSW 7 24,269,985 (GRCm39) missense probably benign 0.05
R4806:Xrcc1 UTSW 7 24,269,905 (GRCm39) missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24,266,988 (GRCm39) missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24,269,643 (GRCm39) missense probably damaging 1.00
R5532:Xrcc1 UTSW 7 24,267,353 (GRCm39) critical splice donor site probably null
R5624:Xrcc1 UTSW 7 24,259,270 (GRCm39) missense possibly damaging 0.57
R6603:Xrcc1 UTSW 7 24,270,459 (GRCm39) nonsense probably null
R6669:Xrcc1 UTSW 7 24,246,762 (GRCm39) missense probably damaging 1.00
R6716:Xrcc1 UTSW 7 24,266,571 (GRCm39) critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24,246,776 (GRCm39) nonsense probably null
R7227:Xrcc1 UTSW 7 24,246,757 (GRCm39) missense probably damaging 1.00
R8204:Xrcc1 UTSW 7 24,271,709 (GRCm39) missense possibly damaging 0.88
R8284:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R8285:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R8287:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R9015:Xrcc1 UTSW 7 24,271,642 (GRCm39) missense probably benign 0.05
R9607:Xrcc1 UTSW 7 24,265,690 (GRCm39) missense probably benign 0.17
X0019:Xrcc1 UTSW 7 24,272,553 (GRCm39) missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24,272,504 (GRCm39) missense probably damaging 1.00
Z1176:Xrcc1 UTSW 7 24,247,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAGTATCGGCCAGACTGGAC -3'
(R):5'- TGGTTTGAGATCGCCTGAGC -3'

Sequencing Primer
(F):5'- ATGTAGGCCTCTGACCTGC -3'
(R):5'- TTGAGATCGCCTGAGCTACCC -3'
Posted On 2017-06-26