Incidental Mutation 'R6276:F2rl1'
ID507666
Institutional Source Beutler Lab
Gene Symbol F2rl1
Ensembl Gene ENSMUSG00000021678
Gene Namecoagulation factor II (thrombin) receptor-like 1
Synonymsproteinase-activated receptor-2, PAR-2, Par2, Gpcr11, Protease-activated receptor-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6276 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95511732-95525227 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 95513938 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 145 (Y145*)
Ref Sequence ENSEMBL: ENSMUSP00000022185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022185]
Predicted Effect probably null
Transcript: ENSMUST00000022185
AA Change: Y145*
SMART Domains Protein: ENSMUSP00000022185
Gene: ENSMUSG00000021678
AA Change: Y145*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 75 363 3.8e-12 PFAM
Pfam:7TM_GPCR_Srw 82 364 1.2e-10 PFAM
Pfam:7tm_1 94 346 1.5e-42 PFAM
low complexity region 375 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 1 family of proteins. The encoded cell surface receptor is activated through proteolytic cleavage of its extracellular amino terminus, resulting in a new amino terminus that acts as a tethered ligand that binds to an extracellular loop domain. Activation of the receptor has been shown to stimulate vascular smooth muscle relaxation, dilate blood vessels, increase blood flow, and lower blood pressure. This protein is also important in the inflammatory response, as well as innate and adaptive immunity. [provided by RefSeq, Jun 2016]
PHENOTYPE: Nullizygous mice may exhibit impaired leukocyte rolling and dendritic cell maturation, altered inflammatory response in various models of acute and chronic inflammatory disease, altered susceptibility to injury and to autoimmune disorders, and abnormal hemodynamic responses and pain thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik T A 11: 58,446,366 I94L possibly damaging Het
4931406P16Rik A T 7: 34,242,377 Y627* probably null Het
Actr3 A T 1: 125,395,137 D364E probably benign Het
Adra2c C T 5: 35,280,079 T65I probably damaging Het
Agap2 T A 10: 127,089,360 probably null Het
Ager T C 17: 34,598,754 V126A possibly damaging Het
Arhgap39 T C 15: 76,737,536 I288M probably benign Het
Arhgap45 A T 10: 80,026,234 S541C probably benign Het
Asb4 A G 6: 5,431,043 Y426C probably damaging Het
Azi2 C T 9: 118,049,338 T82I probably damaging Het
Baz2b T A 2: 59,948,223 R764S probably damaging Het
Ccdc146 A C 5: 21,301,340 I701S probably damaging Het
Cd55b T A 1: 130,418,166 I172F probably damaging Het
Cdk11b A G 4: 155,634,190 E199G probably benign Het
Cntnap4 A T 8: 112,752,289 T216S possibly damaging Het
D5Ertd579e A T 5: 36,604,514 N1336K possibly damaging Het
Dlg5 T C 14: 24,164,568 N649S probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dscaml1 C T 9: 45,668,160 T335I possibly damaging Het
Epb41l2 G T 10: 25,502,124 G695C probably damaging Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
Fam58b T C 11: 78,751,230 K145E probably damaging Het
Fsip2 A T 2: 82,980,441 Y2368F possibly damaging Het
Galnt7 C T 8: 57,536,578 probably null Het
Gm6811 T A 17: 21,093,983 noncoding transcript Het
Gm6811 T G 17: 21,094,690 noncoding transcript Het
H2-M1 G A 17: 36,671,710 T86M possibly damaging Het
Hk2 T C 6: 82,743,366 D170G probably benign Het
Hmcn1 C T 1: 150,738,681 A1325T possibly damaging Het
Insrr T A 3: 87,800,519 Y89* probably null Het
Itga1 T C 13: 114,980,852 E871G probably benign Het
Kat6a T C 8: 22,939,405 L1592P possibly damaging Het
Kndc1 C A 7: 139,921,063 A756E probably benign Het
Krt12 A T 11: 99,421,902 C105* probably null Het
Lama1 G A 17: 67,784,088 probably null Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lrrk1 A G 7: 66,306,839 probably null Het
Map2 T C 1: 66,399,419 V34A probably damaging Het
Mroh6 A G 15: 75,885,700 L487P probably damaging Het
Myo18b A T 5: 112,811,642 S1430T probably benign Het
Notch3 G A 17: 32,154,749 T495I probably benign Het
Olfr391-ps A T 11: 73,799,403 M118K probably damaging Het
Palld C T 8: 61,513,423 A980T probably damaging Het
Paxip1 A T 5: 27,761,668 I620N probably damaging Het
Pcdha6 A G 18: 36,969,767 probably null Het
Pcdhb11 G A 18: 37,421,760 V48M probably benign Het
Pcdhga6 A G 18: 37,707,644 E139G probably benign Het
Pck1 T C 2: 173,157,319 V426A probably damaging Het
Pck2 T A 14: 55,542,624 I110N probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phactr3 G A 2: 178,279,019 E222K probably damaging Het
Ppip5k1 A T 2: 121,323,203 probably benign Het
Prodh2 A G 7: 30,506,651 H278R probably benign Het
Rspry1 T A 8: 94,623,258 H91Q probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Smn1 A G 13: 100,127,995 N78S possibly damaging Het
Spta1 T A 1: 174,218,512 I1614N probably damaging Het
Syt17 T C 7: 118,434,290 D165G probably damaging Het
Tbck A G 3: 132,743,005 Y593C probably damaging Het
Tcaf2 G C 6: 42,629,753 F422L probably benign Het
Tex15 T A 8: 33,577,189 F2216I possibly damaging Het
Trpc4 A G 3: 54,318,020 E846G probably benign Het
Ttc41 T C 10: 86,744,449 I753T probably benign Het
Vdac1 C T 11: 52,376,482 T70M possibly damaging Het
Vmn1r124 A C 7: 21,260,179 F147V probably benign Het
Vmn1r220 T C 13: 23,184,295 D77G probably damaging Het
Vmn2r28 T C 7: 5,490,731 H72R probably benign Het
Vmn2r78 A T 7: 86,921,110 I279L probably benign Het
Vmn2r95 G T 17: 18,451,470 A490S possibly damaging Het
Wdfy4 C T 14: 33,109,525 A915T possibly damaging Het
Zmiz2 G T 11: 6,395,604 probably null Het
Zscan2 A G 7: 80,875,809 N426S probably benign Het
Other mutations in F2rl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:F2rl1 APN 13 95513753 missense probably benign 0.03
IGL01996:F2rl1 APN 13 95513924 missense probably damaging 1.00
IGL02987:F2rl1 APN 13 95514233 missense probably benign 0.00
IGL03053:F2rl1 APN 13 95513618 missense probably benign 0.03
IGL03290:F2rl1 APN 13 95513589 missense possibly damaging 0.89
PIT4382001:F2rl1 UTSW 13 95513646 missense probably benign 0.00
R2005:F2rl1 UTSW 13 95513274 missense probably damaging 1.00
R3794:F2rl1 UTSW 13 95513211 missense unknown
R4236:F2rl1 UTSW 13 95513288 missense probably damaging 1.00
R4715:F2rl1 UTSW 13 95513267 missense probably damaging 0.99
R4741:F2rl1 UTSW 13 95514143 missense probably damaging 1.00
R4799:F2rl1 UTSW 13 95513969 missense possibly damaging 0.81
R4870:F2rl1 UTSW 13 95513984 missense probably damaging 0.99
R5992:F2rl1 UTSW 13 95514270 missense probably benign 0.01
R7568:F2rl1 UTSW 13 95514014 missense probably damaging 1.00
R7761:F2rl1 UTSW 13 95513874 missense probably damaging 1.00
R8087:F2rl1 UTSW 13 95513999 missense probably damaging 1.00
R8281:F2rl1 UTSW 13 95514077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGATTGCCAAGGAGAC -3'
(R):5'- TCGATGAGTTCTCTGCGTCC -3'

Sequencing Primer
(F):5'- GATTGCCAAGGAGACGCCAAC -3'
(R):5'- GAAGCTGACCACGGTCTTTC -3'
Posted On2018-03-15