Incidental Mutation 'R6295:Rgs22'
List |< first << previous [record 40 of 51] next >> last >|
ID508727
Institutional Source Beutler Lab
Gene Symbol Rgs22
Ensembl Gene ENSMUSG00000037627
Gene Nameregulator of G-protein signalling 22
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36009479-36140400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36087374 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 466 (N466S)
Ref Sequence ENSEMBL: ENSMUSP00000134185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172831] [ENSMUST00000174881]
Predicted Effect probably benign
Transcript: ENSMUST00000172737
SMART Domains Protein: ENSMUSP00000133508
Gene: ENSMUSG00000037627

DomainStartEndE-ValueType
Blast:RGS 231 262 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172831
AA Change: N590S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: N590S

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 173 179 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
RGS 845 973 3.15e-2 SMART
RGS 1014 1134 1.56e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174881
AA Change: N466S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134185
Gene: ENSMUSG00000037627
AA Change: N466S

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
RGS 721 849 3.15e-2 SMART
RGS 890 1010 1.56e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Rgs22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Rgs22 APN 15 36099931 missense possibly damaging 0.93
IGL00594:Rgs22 APN 15 36083631 missense probably benign 0.00
IGL01464:Rgs22 APN 15 36083641 missense possibly damaging 0.90
IGL01686:Rgs22 APN 15 36103835 missense probably benign 0.00
IGL01761:Rgs22 APN 15 36103751 missense probably damaging 0.99
IGL02045:Rgs22 APN 15 36013154 missense probably benign 0.33
IGL02378:Rgs22 APN 15 36103805 missense probably benign 0.00
IGL02490:Rgs22 APN 15 36054847 missense probably damaging 1.00
IGL03219:Rgs22 APN 15 36107048 missense probably damaging 1.00
IGL03229:Rgs22 APN 15 36015779 splice site probably benign
IGL03328:Rgs22 APN 15 36043204 critical splice donor site probably null
3-1:Rgs22 UTSW 15 36100036 missense possibly damaging 0.48
R0254:Rgs22 UTSW 15 36104552 missense probably damaging 0.99
R0463:Rgs22 UTSW 15 36092938 missense probably damaging 1.00
R0467:Rgs22 UTSW 15 36099795 nonsense probably null
R0486:Rgs22 UTSW 15 36092882 missense probably damaging 0.98
R0554:Rgs22 UTSW 15 36054709 missense probably benign 0.10
R0602:Rgs22 UTSW 15 36139872 splice site probably benign
R0906:Rgs22 UTSW 15 36103902 intron probably benign
R1159:Rgs22 UTSW 15 36040693 missense probably damaging 1.00
R1300:Rgs22 UTSW 15 36101762 missense probably benign 0.43
R1439:Rgs22 UTSW 15 36025793 splice site probably benign
R1491:Rgs22 UTSW 15 36092901 missense probably damaging 0.98
R1502:Rgs22 UTSW 15 36080851 missense probably damaging 1.00
R1514:Rgs22 UTSW 15 36013100 missense probably benign 0.00
R1538:Rgs22 UTSW 15 36048776 missense probably damaging 1.00
R1784:Rgs22 UTSW 15 36087436 missense probably damaging 1.00
R1938:Rgs22 UTSW 15 36101804 missense probably benign 0.00
R1972:Rgs22 UTSW 15 36103836 missense probably benign 0.01
R2109:Rgs22 UTSW 15 36099734 nonsense probably null
R2208:Rgs22 UTSW 15 36050232 missense probably benign 0.01
R3696:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3697:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3698:Rgs22 UTSW 15 36099892 missense probably benign 0.00
R3879:Rgs22 UTSW 15 36106905 missense possibly damaging 0.52
R4080:Rgs22 UTSW 15 36107076 missense probably damaging 1.00
R4363:Rgs22 UTSW 15 36103874 missense probably damaging 0.99
R4591:Rgs22 UTSW 15 36100136 missense probably benign 0.01
R4673:Rgs22 UTSW 15 36099933 missense probably benign 0.04
R4829:Rgs22 UTSW 15 36103888 missense probably damaging 1.00
R4831:Rgs22 UTSW 15 36050148 missense probably benign 0.00
R4865:Rgs22 UTSW 15 36100212 missense probably damaging 1.00
R4907:Rgs22 UTSW 15 36087424 missense possibly damaging 0.61
R4944:Rgs22 UTSW 15 36025942 missense possibly damaging 0.83
R4975:Rgs22 UTSW 15 36054876 nonsense probably null
R5056:Rgs22 UTSW 15 36050245 unclassified probably null
R5126:Rgs22 UTSW 15 36040644 missense probably damaging 0.96
R5138:Rgs22 UTSW 15 36099788 missense probably benign 0.04
R5444:Rgs22 UTSW 15 36015627 missense possibly damaging 0.83
R5507:Rgs22 UTSW 15 36099652 missense probably damaging 0.99
R5640:Rgs22 UTSW 15 36106955 missense probably benign 0.00
R5969:Rgs22 UTSW 15 36015636 missense probably benign 0.00
R6005:Rgs22 UTSW 15 36010567 missense probably benign 0.39
R6053:Rgs22 UTSW 15 36100007 missense probably benign 0.04
R6134:Rgs22 UTSW 15 36107048 missense probably damaging 1.00
R6230:Rgs22 UTSW 15 36100030 missense probably benign 0.02
R6352:Rgs22 UTSW 15 36092921 missense probably damaging 1.00
R6809:Rgs22 UTSW 15 36048764 missense probably damaging 1.00
R6900:Rgs22 UTSW 15 36010747 missense possibly damaging 0.61
R6947:Rgs22 UTSW 15 36103890 critical splice acceptor site probably null
R7102:Rgs22 UTSW 15 36122313 missense probably damaging 1.00
R7126:Rgs22 UTSW 15 36103808 missense probably damaging 0.97
R7263:Rgs22 UTSW 15 36015643 missense possibly damaging 0.86
R7623:Rgs22 UTSW 15 36040710 missense probably benign 0.08
R7732:Rgs22 UTSW 15 36025981 missense probably damaging 1.00
R7748:Rgs22 UTSW 15 36122269 critical splice donor site probably null
R7771:Rgs22 UTSW 15 36050078 missense possibly damaging 0.94
R7835:Rgs22 UTSW 15 36081911 critical splice donor site probably null
R7849:Rgs22 UTSW 15 36099712 missense probably damaging 1.00
R7918:Rgs22 UTSW 15 36081911 critical splice donor site probably null
R7932:Rgs22 UTSW 15 36099712 missense probably damaging 1.00
RF035:Rgs22 UTSW 15 36010835 critical splice acceptor site probably benign
RF043:Rgs22 UTSW 15 36010836 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGGGTTCTTCTAACTTAGAGC -3'
(R):5'- GTGGGCTGACGGTTGAAATC -3'

Sequencing Primer
(F):5'- CTTCTAACTTAGAGCAGGCAGGTC -3'
(R):5'- CCACAGCAAGTTGAGGTATACATGC -3'
Posted On2018-04-02