Mutagenetix > Incidental Mutations

Incidental Mutation 'R8516:Rgs22'

656174

Institutional Source

Beutler Lab

Gene Symbol

Rgs22

Ensembl Gene

ENSMUSG00000037627

Gene Name

regulator of G-protein signalling 22

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8516 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36009479-36140400 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 36010335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 1259 (*1259Q)

Ref Sequence

ENSEMBL: ENSMUSP00000134259 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172831]

AlphaFold

G3UYX5

Predicted Effect

probably null
Transcript: ENSMUST00000172831
AA Change: *1259Q

SMART Domains

Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: *1259Q

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
low complexity region	62	76	N/A	INTRINSIC
low complexity region	173	179	N/A	INTRINSIC
low complexity region	376	391	N/A	INTRINSIC
RGS	845	973	3.15e-2	SMART
RGS	1014	1134	1.56e-15	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000173018
AA Change: *219Q

SMART Domains

Protein: ENSMUSP00000133703
Gene: ENSMUSG00000037627
AA Change: *219Q

Domain	Start	End	E-Value	Type
RGS	4	124	1.56e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,373	S22T	probably benign	Het
Actr8	G	T	14: 29,990,899	A500S	probably benign	Het
Adamtsl1	A	G	4: 86,342,543	Y1005C	probably damaging	Het
Ank3	T	A	10: 69,927,729	Y884*	probably null	Het
Arhgap28	T	C	17: 67,873,073	R306G	probably benign	Het
Atp8a2	A	C	14: 59,691,472	I1044M	probably benign	Het
Bahd1	A	G	2: 118,916,971	Y357C	probably benign	Het
Btd	A	T	14: 31,666,867	T182S	probably damaging	Het
Casc3	C	T	11: 98,822,781	R280C	probably damaging	Het
Cisd2	T	C	3: 135,411,013	T106A	probably damaging	Het
Cldn15	G	T	5: 136,974,696	C184F	probably damaging	Het
Clk4	G	A	11: 51,275,261	R198Q	probably damaging	Het
Coprs	G	T	8: 13,885,065	F163L	probably damaging	Het
Csmd3	G	A	15: 47,629,365	R2216*	probably null	Het
Defb7	A	T	8: 19,497,607	I43F	possibly damaging	Het
Dpp8	C	A	9: 65,078,009	T783K	probably damaging	Het
Eif2s1	G	A	12: 78,881,162	G204D	probably damaging	Het
Elavl4	T	C	4: 110,251,379	N56S	probably damaging	Het
Emilin1	G	A	5: 30,917,171	R252H	probably damaging	Het
Exd1	A	T	2: 119,520,073	L569Q	probably damaging	Het
Gm498	T	A	7: 143,897,274	I342N	probably damaging	Het
Gpn2	C	T	4: 133,584,831	R125C	probably damaging	Het
Gria2	T	C	3: 80,706,987	E582G	probably benign	Het
Hadha	A	T	5: 30,126,584	V458E	probably damaging	Het
Hap1	T	C	11: 100,356,067	K4R	possibly damaging	Het
Hectd4	A	T	5: 121,349,010	H3356L	possibly damaging	Het
Herc2	G	A	7: 56,206,570	V3919I	probably benign	Het
Lgr6	G	T	1: 135,075,283	N76K	probably damaging	Het
Olfr692	A	G	7: 105,368,769	I148V	probably benign	Het
P4ha3	A	G	7: 100,314,662	M462V	probably damaging	Het
Pde3b	A	T	7: 114,526,849	M773L	probably benign	Het
Peak1	T	C	9: 56,260,000	S215G	probably damaging	Het
Pgm5	T	A	19: 24,815,710	M331L	probably benign	Het
Piwil2	A	G	14: 70,420,739	V213A	probably benign	Het
Plch2	T	C	4: 154,986,307	H1205R	probably benign	Het
Pop4	A	T	7: 38,267,402	M85K	probably benign	Het
Ppp3ca	T	A	3: 136,877,768	I212N	probably damaging	Het
Prom1	T	C	5: 44,007,099	K714R	probably benign	Het
Psip1	C	T	4: 83,466,715	G207S	probably benign	Het
Scn1a	C	T	2: 66,326,134	G477D	possibly damaging	Het
Sf3b1	T	C	1: 55,012,103	E222G	probably null	Het
Snrpa1	G	A	7: 66,070,633	G195R	probably benign	Het
Spem2	T	C	11: 69,816,895	R415G	possibly damaging	Het
Tmem167	T	A	13: 90,098,396	V13E	probably damaging	Het
Trim2	C	T	3: 84,208,320	A102T	probably damaging	Het
Trim30b	A	G	7: 104,357,404	S82P	probably benign	Het
Uba6	A	C	5: 86,127,748	S760R	possibly damaging	Het
Upf2	T	C	2: 6,018,971	F711L	unknown	Het
Utrn	T	A	10: 12,486,510	D2693V	probably damaging	Het
Vmn1r30	T	G	6: 58,435,124	Y241S	probably damaging	Het
Vmn2r110	A	G	17: 20,574,613	L598P	probably damaging	Het
Wfdc18	T	A	11: 83,709,158	F14Y	probably benign	Het
Wnt10b	A	T	15: 98,772,880	C256S	probably damaging	Het
Xrn1	T	A	9: 96,048,391	Y1554*	probably null	Het
Zc3h12a	T	A	4: 125,119,839	S411C	probably damaging	Het
Zfp112	G	A	7: 24,123,964	G63E	probably benign	Het
Zfp786	A	T	6: 47,820,543	L487Q	probably damaging	Het
Zfp953	T	A	13: 67,345,355	Y75F	possibly damaging	Het

Other mutations in Rgs22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Rgs22	APN	15	36099931	missense	possibly damaging	0.93
IGL00594:Rgs22	APN	15	36083631	missense	probably benign	0.00
IGL01464:Rgs22	APN	15	36083641	missense	possibly damaging	0.90
IGL01686:Rgs22	APN	15	36103835	missense	probably benign	0.00
IGL01761:Rgs22	APN	15	36103751	missense	probably damaging	0.99
IGL02045:Rgs22	APN	15	36013154	missense	probably benign	0.33
IGL02378:Rgs22	APN	15	36103805	missense	probably benign	0.00
IGL02490:Rgs22	APN	15	36054847	missense	probably damaging	1.00
IGL03219:Rgs22	APN	15	36107048	missense	probably damaging	1.00
IGL03229:Rgs22	APN	15	36015779	splice site	probably benign
IGL03328:Rgs22	APN	15	36043204	critical splice donor site	probably null
3-1:Rgs22	UTSW	15	36100036	missense	possibly damaging	0.48
R0254:Rgs22	UTSW	15	36104552	missense	probably damaging	0.99
R0463:Rgs22	UTSW	15	36092938	missense	probably damaging	1.00
R0467:Rgs22	UTSW	15	36099795	nonsense	probably null
R0486:Rgs22	UTSW	15	36092882	missense	probably damaging	0.98
R0554:Rgs22	UTSW	15	36054709	missense	probably benign	0.10
R0602:Rgs22	UTSW	15	36139872	splice site	probably benign
R0906:Rgs22	UTSW	15	36103902	intron	probably benign
R1159:Rgs22	UTSW	15	36040693	missense	probably damaging	1.00
R1300:Rgs22	UTSW	15	36101762	missense	probably benign	0.43
R1439:Rgs22	UTSW	15	36025793	splice site	probably benign
R1491:Rgs22	UTSW	15	36092901	missense	probably damaging	0.98
R1502:Rgs22	UTSW	15	36080851	missense	probably damaging	1.00
R1514:Rgs22	UTSW	15	36013100	missense	probably benign	0.00
R1538:Rgs22	UTSW	15	36048776	missense	probably damaging	1.00
R1784:Rgs22	UTSW	15	36087436	missense	probably damaging	1.00
R1938:Rgs22	UTSW	15	36101804	missense	probably benign	0.00
R1972:Rgs22	UTSW	15	36103836	missense	probably benign	0.01
R2109:Rgs22	UTSW	15	36099734	nonsense	probably null
R2208:Rgs22	UTSW	15	36050232	missense	probably benign	0.01
R3696:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3697:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3698:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3879:Rgs22	UTSW	15	36106905	missense	possibly damaging	0.52
R4080:Rgs22	UTSW	15	36107076	missense	probably damaging	1.00
R4363:Rgs22	UTSW	15	36103874	missense	probably damaging	0.99
R4591:Rgs22	UTSW	15	36100136	missense	probably benign	0.01
R4673:Rgs22	UTSW	15	36099933	missense	probably benign	0.04
R4829:Rgs22	UTSW	15	36103888	missense	probably damaging	1.00
R4831:Rgs22	UTSW	15	36050148	missense	probably benign	0.00
R4865:Rgs22	UTSW	15	36100212	missense	probably damaging	1.00
R4907:Rgs22	UTSW	15	36087424	missense	possibly damaging	0.61
R4944:Rgs22	UTSW	15	36025942	missense	possibly damaging	0.83
R4975:Rgs22	UTSW	15	36054876	nonsense	probably null
R5056:Rgs22	UTSW	15	36050245	splice site	probably null
R5126:Rgs22	UTSW	15	36040644	missense	probably damaging	0.96
R5138:Rgs22	UTSW	15	36099788	missense	probably benign	0.04
R5444:Rgs22	UTSW	15	36015627	missense	possibly damaging	0.83
R5507:Rgs22	UTSW	15	36099652	missense	probably damaging	0.99
R5640:Rgs22	UTSW	15	36106955	missense	probably benign	0.00
R5969:Rgs22	UTSW	15	36015636	missense	probably benign	0.00
R6005:Rgs22	UTSW	15	36010567	missense	probably benign	0.39
R6053:Rgs22	UTSW	15	36100007	missense	probably benign	0.04
R6134:Rgs22	UTSW	15	36107048	missense	probably damaging	1.00
R6230:Rgs22	UTSW	15	36100030	missense	probably benign	0.02
R6295:Rgs22	UTSW	15	36087374	missense	probably benign	0.00
R6352:Rgs22	UTSW	15	36092921	missense	probably damaging	1.00
R6809:Rgs22	UTSW	15	36048764	missense	probably damaging	1.00
R6900:Rgs22	UTSW	15	36010747	missense	possibly damaging	0.61
R6947:Rgs22	UTSW	15	36103890	critical splice acceptor site	probably null
R7102:Rgs22	UTSW	15	36122313	missense	probably damaging	1.00
R7126:Rgs22	UTSW	15	36103808	missense	probably damaging	0.97
R7263:Rgs22	UTSW	15	36015643	missense	possibly damaging	0.86
R7623:Rgs22	UTSW	15	36040710	missense	probably benign	0.08
R7732:Rgs22	UTSW	15	36025981	missense	probably damaging	1.00
R7748:Rgs22	UTSW	15	36122269	critical splice donor site	probably null
R7771:Rgs22	UTSW	15	36050078	missense	possibly damaging	0.94
R7835:Rgs22	UTSW	15	36081911	critical splice donor site	probably null
R7849:Rgs22	UTSW	15	36099712	missense	probably damaging	1.00
R7954:Rgs22	UTSW	15	36082002	missense	possibly damaging	0.75
R8384:Rgs22	UTSW	15	36046012	critical splice donor site	probably null
R8904:Rgs22	UTSW	15	36025981	missense	probably damaging	1.00
R8923:Rgs22	UTSW	15	36092960	missense	probably damaging	1.00
R9287:Rgs22	UTSW	15	36098263	missense	probably damaging	1.00
R9324:Rgs22	UTSW	15	36087398	missense	probably benign
RF035:Rgs22	UTSW	15	36010835	critical splice acceptor site	probably benign
RF043:Rgs22	UTSW	15	36010836	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- CAATCAGAAGACAAGCTGTTGC -3'
(R):5'- TCTTCACAGCATCCAGAGTCAG -3'

Sequencing Primer
(F):5'- CTACCCTTTGGTTGGAGGTGAG -3'
(R):5'- ATCCAGAGTCAGTTCCCGTGATTG -3'

Posted On

2020-10-20