Incidental Mutation 'R6295:Bmp1'
ID 508725
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 044463-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6295 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70474558-70520234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 70491383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 583 (Y583S)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect possibly damaging
Transcript: ENSMUST00000022693
AA Change: Y583S

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y583S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226601
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228501
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70508004 missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4609:Bmp1 UTSW 14 70477966 missense probably benign 0.00
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6155:Bmp1 UTSW 14 70508007 missense probably damaging 1.00
R6618:Bmp1 UTSW 14 70491368 missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70490122 missense probably benign 0.44
R7716:Bmp1 UTSW 14 70477922 nonsense probably null
R7749:Bmp1 UTSW 14 70492844 missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70492084 missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70508565 missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70519889 missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70490133 missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70490642 missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70490190 missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70490173 missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70519898 missense probably benign
R9621:Bmp1 UTSW 14 70477866 missense probably benign 0.29
R9652:Bmp1 UTSW 14 70477920 missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCACACCCTGCCAGTG -3'
(R):5'- ACTCCTCTCTGCAACATGGG -3'

Sequencing Primer
(F):5'- ACACCCTGCCAGTGTTCTG -3'
(R):5'- GGGCCATAGGAACTTGAACCTC -3'
Posted On 2018-04-02