Incidental Mutation 'R6602:Rab11fip2'
ID525398
Institutional Source Beutler Lab
Gene Symbol Rab11fip2
Ensembl Gene ENSMUSG00000040022
Gene NameRAB11 family interacting protein 2 (class I)
SynonymsA830046J09Rik, 4930470G04Rik, Rab11-FIP2, nRip11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location59902884-59943654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59942856 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 49 (T49S)
Ref Sequence ENSEMBL: ENSMUSP00000133151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051996] [ENSMUST00000170819] [ENSMUST00000171986]
Predicted Effect probably damaging
Transcript: ENSMUST00000051996
AA Change: T49S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059978
Gene: ENSMUSG00000040022
AA Change: T49S

DomainStartEndE-ValueType
C2 14 117 1.75e-11 SMART
low complexity region 344 358 N/A INTRINSIC
Pfam:RBD-FIP 452 499 3.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168140
Predicted Effect probably damaging
Transcript: ENSMUST00000170819
AA Change: T49S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133151
Gene: ENSMUSG00000040022
AA Change: T49S

DomainStartEndE-ValueType
C2 14 117 1.75e-11 SMART
low complexity region 344 358 N/A INTRINSIC
Pfam:RBD-FIP 452 499 3.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171986
SMART Domains Protein: ENSMUSP00000128813
Gene: ENSMUSG00000040022

DomainStartEndE-ValueType
low complexity region 202 216 N/A INTRINSIC
Pfam:RBD-FIP 310 357 3.9e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Rab11fip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02883:Rab11fip2 APN 19 59906998 missense probably damaging 1.00
R0081:Rab11fip2 UTSW 19 59907135 missense possibly damaging 0.87
R0466:Rab11fip2 UTSW 19 59906243 missense possibly damaging 0.90
R1690:Rab11fip2 UTSW 19 59937300 missense probably damaging 1.00
R1718:Rab11fip2 UTSW 19 59935649 missense probably damaging 1.00
R1884:Rab11fip2 UTSW 19 59937330 missense probably damaging 1.00
R4196:Rab11fip2 UTSW 19 59935781 missense probably damaging 1.00
R4680:Rab11fip2 UTSW 19 59936020 missense probably benign 0.00
R4746:Rab11fip2 UTSW 19 59937110 missense probably damaging 1.00
R4934:Rab11fip2 UTSW 19 59935858 missense probably damaging 1.00
R5032:Rab11fip2 UTSW 19 59937367 missense probably damaging 1.00
R5721:Rab11fip2 UTSW 19 59935610 missense probably damaging 1.00
R6294:Rab11fip2 UTSW 19 59937099 missense probably damaging 1.00
R6694:Rab11fip2 UTSW 19 59937275 missense probably damaging 1.00
R6752:Rab11fip2 UTSW 19 59907043 missense probably damaging 1.00
R6850:Rab11fip2 UTSW 19 59937009 missense possibly damaging 0.58
R7350:Rab11fip2 UTSW 19 59937421 missense probably benign 0.00
R7636:Rab11fip2 UTSW 19 59942885 missense possibly damaging 0.72
R7875:Rab11fip2 UTSW 19 59937223 missense possibly damaging 0.91
R8252:Rab11fip2 UTSW 19 59936990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGATTGATTGCCACCTGCC -3'
(R):5'- ATGCAGTGATCAGGGTACGG -3'

Sequencing Primer
(F):5'- TTGATTGCCACCTGCCCTAAAAAC -3'
(R):5'- GCTTCTGAACTCTGCGCAG -3'
Posted On2018-06-22