Incidental Mutation 'R6602:Sphkap'
ID525316
Institutional Source Beutler Lab
Gene Symbol Sphkap
Ensembl Gene ENSMUSG00000026163
Gene NameSPHK1 interactor, AKAP domain containing
Synonyms4930544G21Rik, A930009L15Rik, SKIP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location83254139-83408200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83275758 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1423 (K1423N)
Ref Sequence ENSEMBL: ENSMUSP00000124872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053075
Predicted Effect possibly damaging
Transcript: ENSMUST00000159078
AA Change: K1136N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: K1136N

DomainStartEndE-ValueType
low complexity region 303 314 N/A INTRINSIC
SCOP:d1ash__ 382 462 5e-3 SMART
low complexity region 809 819 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 1202 1221 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
Pfam:AKAP_110 1281 1398 7.5e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160953
AA Change: K1423N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: K1423N

DomainStartEndE-ValueType
low complexity region 590 601 N/A INTRINSIC
SCOP:d1ash__ 669 749 6e-3 SMART
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
Pfam:AKAP_110 1540 1655 6.4e-12 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Sphkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sphkap APN 1 83280516 missense probably damaging 1.00
IGL00337:Sphkap APN 1 83339608 missense probably damaging 1.00
IGL00470:Sphkap APN 1 83277910 missense possibly damaging 0.87
IGL00577:Sphkap APN 1 83278844 missense probably damaging 1.00
IGL00657:Sphkap APN 1 83276375 missense probably damaging 1.00
IGL01868:Sphkap APN 1 83280399 splice site probably null
IGL02101:Sphkap APN 1 83290987 missense probably damaging 1.00
IGL02471:Sphkap APN 1 83276176 missense probably damaging 1.00
IGL02943:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL02945:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03008:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03031:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03059:Sphkap APN 1 83257242 missense probably damaging 0.97
IGL03085:Sphkap APN 1 83280354 missense possibly damaging 0.92
IGL03355:Sphkap APN 1 83280503 missense probably damaging 1.00
IGL03356:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03368:Sphkap APN 1 83275676 missense probably benign 0.14
R0294:Sphkap UTSW 1 83278245 missense possibly damaging 0.72
R0308:Sphkap UTSW 1 83276969 missense probably damaging 1.00
R0478:Sphkap UTSW 1 83278711 missense probably damaging 1.00
R0606:Sphkap UTSW 1 83280424 missense probably damaging 1.00
R0678:Sphkap UTSW 1 83278628 missense probably benign 0.03
R1216:Sphkap UTSW 1 83290977 missense probably damaging 1.00
R1253:Sphkap UTSW 1 83278898 missense possibly damaging 0.56
R1532:Sphkap UTSW 1 83257203 missense probably damaging 1.00
R1635:Sphkap UTSW 1 83278400 missense probably benign 0.03
R1655:Sphkap UTSW 1 83277515 nonsense probably null
R1657:Sphkap UTSW 1 83277515 nonsense probably null
R1700:Sphkap UTSW 1 83277515 nonsense probably null
R1701:Sphkap UTSW 1 83277515 nonsense probably null
R1734:Sphkap UTSW 1 83277515 nonsense probably null
R1736:Sphkap UTSW 1 83277515 nonsense probably null
R1743:Sphkap UTSW 1 83277515 nonsense probably null
R1744:Sphkap UTSW 1 83277515 nonsense probably null
R1760:Sphkap UTSW 1 83277544 missense probably benign 0.29
R1893:Sphkap UTSW 1 83278966 missense probably benign 0.02
R1937:Sphkap UTSW 1 83267441 nonsense probably null
R1986:Sphkap UTSW 1 83277922 missense probably damaging 1.00
R1993:Sphkap UTSW 1 83277515 nonsense probably null
R1995:Sphkap UTSW 1 83277515 nonsense probably null
R2001:Sphkap UTSW 1 83276662 missense probably damaging 1.00
R2004:Sphkap UTSW 1 83277911 missense probably benign 0.04
R2111:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2112:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2156:Sphkap UTSW 1 83277989 missense probably benign 0.03
R2182:Sphkap UTSW 1 83276684 missense probably damaging 1.00
R2271:Sphkap UTSW 1 83257221 missense probably damaging 1.00
R3712:Sphkap UTSW 1 83277112 missense probably benign 0.27
R3919:Sphkap UTSW 1 83276458 missense probably damaging 1.00
R3980:Sphkap UTSW 1 83267494 splice site probably null
R4130:Sphkap UTSW 1 83277898 missense probably damaging 0.96
R4539:Sphkap UTSW 1 83277793 missense probably benign 0.00
R4602:Sphkap UTSW 1 83279061 nonsense probably null
R4735:Sphkap UTSW 1 83279117 missense probably benign 0.01
R4793:Sphkap UTSW 1 83278084 missense possibly damaging 0.77
R4849:Sphkap UTSW 1 83277384 missense probably benign 0.03
R4880:Sphkap UTSW 1 83288817 missense probably damaging 1.00
R5213:Sphkap UTSW 1 83280503 missense probably damaging 1.00
R5277:Sphkap UTSW 1 83276164 missense probably benign 0.04
R5331:Sphkap UTSW 1 83276782 missense probably benign 0.08
R5632:Sphkap UTSW 1 83278285 missense probably benign 0.01
R5647:Sphkap UTSW 1 83407999 missense probably damaging 0.98
R5751:Sphkap UTSW 1 83275897 missense probably benign 0.27
R5935:Sphkap UTSW 1 83339599 missense probably damaging 1.00
R5999:Sphkap UTSW 1 83267405 missense probably benign 0.02
R6232:Sphkap UTSW 1 83280479 missense probably damaging 1.00
R6318:Sphkap UTSW 1 83278378 missense probably damaging 1.00
R6474:Sphkap UTSW 1 83278823 missense probably damaging 1.00
R6674:Sphkap UTSW 1 83277834 missense probably benign 0.37
R6716:Sphkap UTSW 1 83362228 critical splice donor site probably null
R6803:Sphkap UTSW 1 83280510 missense probably damaging 1.00
R6880:Sphkap UTSW 1 83257257 missense probably damaging 1.00
R6941:Sphkap UTSW 1 83408090 start gained probably benign
R7170:Sphkap UTSW 1 83265985 missense probably damaging 0.99
R7263:Sphkap UTSW 1 83276678 missense probably damaging 1.00
R7422:Sphkap UTSW 1 83263826 missense probably benign 0.02
R7640:Sphkap UTSW 1 83278928 missense possibly damaging 0.94
R7722:Sphkap UTSW 1 83278921 missense probably benign 0.00
R7810:Sphkap UTSW 1 83276300 missense probably damaging 1.00
R7887:Sphkap UTSW 1 83277412 missense probably benign 0.00
R7974:Sphkap UTSW 1 83278962 missense probably damaging 1.00
R7990:Sphkap UTSW 1 83267345 missense probably damaging 0.99
R8096:Sphkap UTSW 1 83277558 missense probably damaging 0.98
R8110:Sphkap UTSW 1 83278771 missense possibly damaging 0.82
R8125:Sphkap UTSW 1 83263582 missense probably damaging 1.00
R8153:Sphkap UTSW 1 83278009 missense possibly damaging 0.93
R8245:Sphkap UTSW 1 83278771 missense probably benign 0.14
R8394:Sphkap UTSW 1 83276076 missense probably benign 0.08
R8443:Sphkap UTSW 1 83278232 missense probably benign 0.00
R8508:Sphkap UTSW 1 83276500 missense probably damaging 1.00
R8531:Sphkap UTSW 1 83277188 missense probably damaging 1.00
R8673:Sphkap UTSW 1 83275840 missense probably benign 0.01
R8674:Sphkap UTSW 1 83277844 missense probably benign 0.04
R8682:Sphkap UTSW 1 83279276 missense probably benign 0.21
R8837:Sphkap UTSW 1 83275663 missense possibly damaging 0.87
R8857:Sphkap UTSW 1 83280567 missense probably damaging 1.00
R8902:Sphkap UTSW 1 83278964 missense probably benign 0.21
R8916:Sphkap UTSW 1 83277387 missense possibly damaging 0.87
R8944:Sphkap UTSW 1 83279206 missense probably benign 0.39
Z1088:Sphkap UTSW 1 83276608 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83278604 missense probably damaging 1.00
Z1176:Sphkap UTSW 1 83276033 nonsense probably null
Z1176:Sphkap UTSW 1 83280442 missense possibly damaging 0.61
Z1177:Sphkap UTSW 1 83276431 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAGCCCTGTATGGTTTAAGAGG -3'
(R):5'- GGCCAACTCTGCTTGTACAG -3'

Sequencing Primer
(F):5'- GTGATCAACTTACCGAGAGCTCTG -3'
(R):5'- CAACTCTGCTTGTACAGGAATCTG -3'
Posted On2018-06-22