Incidental Mutation 'R6602:Rtn1'
ID525376
Institutional Source Beutler Lab
Gene Symbol Rtn1
Ensembl Gene ENSMUSG00000021087
Gene Namereticulon 1
SynonymsRtn1-c, 0710005K15Rik, Nsp, Rtn1-b, Rtn1-a, 4930441F12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location72211752-72409054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72219318 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 161 (N161S)
Ref Sequence ENSEMBL: ENSMUSP00000120033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021497] [ENSMUST00000078505] [ENSMUST00000137990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021497
AA Change: N116S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021497
Gene: ENSMUSG00000021087
AA Change: N116S

DomainStartEndE-ValueType
Pfam:Reticulon 21 191 1.2e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078505
AA Change: N688S

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077594
Gene: ENSMUSG00000021087
AA Change: N688S

DomainStartEndE-ValueType
low complexity region 135 152 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 438 448 N/A INTRINSIC
low complexity region 473 480 N/A INTRINSIC
low complexity region 574 586 N/A INTRINSIC
Pfam:Reticulon 593 757 2.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137990
AA Change: N161S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120033
Gene: ENSMUSG00000021087
AA Change: N161S

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Reticulon 66 236 2.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150156
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Rtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Rtn1 APN 12 72408511 missense probably benign 0.18
IGL01335:Rtn1 APN 12 72308350 missense probably benign
IGL01394:Rtn1 APN 12 72308416 missense probably benign 0.00
IGL01551:Rtn1 APN 12 72216935 missense possibly damaging 0.63
IGL01865:Rtn1 APN 12 72219300 missense probably damaging 1.00
IGL02585:Rtn1 APN 12 72308155 critical splice donor site probably null
PIT4802001:Rtn1 UTSW 12 72304326 missense probably benign 0.21
R0104:Rtn1 UTSW 12 72308845 missense probably damaging 0.99
R0866:Rtn1 UTSW 12 72308382 nonsense probably null
R1099:Rtn1 UTSW 12 72304467 intron probably null
R1438:Rtn1 UTSW 12 72304413 missense probably damaging 0.98
R1610:Rtn1 UTSW 12 72219279 missense possibly damaging 0.90
R1694:Rtn1 UTSW 12 72223524 missense probably damaging 1.00
R1869:Rtn1 UTSW 12 72308168 missense probably damaging 1.00
R1888:Rtn1 UTSW 12 72236533 intron probably benign
R1889:Rtn1 UTSW 12 72304410 missense possibly damaging 0.87
R1892:Rtn1 UTSW 12 72212563 missense probably damaging 1.00
R2418:Rtn1 UTSW 12 72304278 missense probably benign
R2760:Rtn1 UTSW 12 72408362 missense probably benign 0.00
R2973:Rtn1 UTSW 12 72223389 missense probably damaging 1.00
R4567:Rtn1 UTSW 12 72212487 utr 3 prime probably benign
R4880:Rtn1 UTSW 12 72217458 missense possibly damaging 0.88
R4945:Rtn1 UTSW 12 72217484 missense probably damaging 1.00
R6183:Rtn1 UTSW 12 72408491 missense probably benign 0.09
R6493:Rtn1 UTSW 12 72308329 missense probably damaging 0.99
R6547:Rtn1 UTSW 12 72308761 missense possibly damaging 0.59
R7474:Rtn1 UTSW 12 72308390 missense possibly damaging 0.87
R7615:Rtn1 UTSW 12 72304143 missense probably damaging 1.00
R7697:Rtn1 UTSW 12 72408377 missense probably benign 0.32
R7748:Rtn1 UTSW 12 72216926 missense possibly damaging 0.53
R7754:Rtn1 UTSW 12 72308429 missense probably damaging 0.96
R7834:Rtn1 UTSW 12 72304032 missense probably damaging 0.99
R7917:Rtn1 UTSW 12 72304032 missense probably damaging 0.99
Z1177:Rtn1 UTSW 12 72308864 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACGCTCAGATTCTAGACTAATTAGCAC -3'
(R):5'- TCAGAACTTCTGCCCTCCAG -3'

Sequencing Primer
(F):5'- CACTTGCTGTGTAGTCTCTGAATTG -3'
(R):5'- TAATCCTTGAAGGTGACCCAGC -3'
Posted On2018-06-22